Hi All,
I need to use Miseq for sequencing a pool of multiplexed PCR amplicons through in-house PCR amplicon preparation procedure (for various reasons) using custom-ordered adapters and primers. Based on the sequence information provided by Illumina, my PCR amplicons look like this:
(5' to 3', single strand shown here)
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT(NNNNNN)(INSERTSEQUENCE)AGATCGGAAGAGCACAGTCTGAACTCCAGTCACatcacgATCTCGTATGCCGTCTTCTGCTTG
where NNNNNN - a random hexamer sequence for each amplicon population (used to avoid low complexity problem)
insert sequence - somewhat homogeneous amplified sequence but not completely (50 - 150 bp in size)
lower case - One of Illumina index sequences
I am planning to pool together 20 samples, each with different N6, insert sequence, and Index sequence and sequence them as a single sample in Miseq. Can anyone help me with the possibility of sending this sample for Miseq or not ?
Thank you in advance.
windhorse
I need to use Miseq for sequencing a pool of multiplexed PCR amplicons through in-house PCR amplicon preparation procedure (for various reasons) using custom-ordered adapters and primers. Based on the sequence information provided by Illumina, my PCR amplicons look like this:
(5' to 3', single strand shown here)
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT(NNNNNN)(INSERTSEQUENCE)AGATCGGAAGAGCACAGTCTGAACTCCAGTCACatcacgATCTCGTATGCCGTCTTCTGCTTG
where NNNNNN - a random hexamer sequence for each amplicon population (used to avoid low complexity problem)
insert sequence - somewhat homogeneous amplified sequence but not completely (50 - 150 bp in size)
lower case - One of Illumina index sequences
I am planning to pool together 20 samples, each with different N6, insert sequence, and Index sequence and sequence them as a single sample in Miseq. Can anyone help me with the possibility of sending this sample for Miseq or not ?
Thank you in advance.
windhorse
Comment