In designing reverse primer for amplicon Ion Torrent, should I use B adapter (CCTATCCCCTGTGTGCCTTGGCAGTCTCAG) or P1 adapter (CCTCTCTATGGGCAGTCGGTGAT)? I have two Ion Torrent application notes, both dated 2011, and they have conflicting information. Also, the B-adapter design contains the key sequence TCAG, but P1 does not. Is that right that when I use the P1 adapter, the B adapter and key are added in e-PCR?
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
Originally posted by Retro View PostIn designing reverse primer for amplicon Ion Torrent, should I use B adapter (CCTATCCCCTGTGTGCCTTGGCAGTCTCAG) or P1 adapter (CCTCTCTATGGGCAGTCGGTGAT)? I have two Ion Torrent application notes, both dated 2011, and they have conflicting information. Also, the B-adapter design contains the key sequence TCAG, but P1 does not. Is that right that when I use the P1 adapter, the B adapter and key are added in e-PCR?
This strategy employs A and P1-tagged fusion primers.
Comment
-
The version with P1 reverse primer is here:
The version with B reverse primer:
The version with P1 seems more recent, so probably correct. However, I guess the B and key will be added in the e-PCR. That will only make the 3' end adapter end longer by the 23 bp of the P1 sequence. This will further limit the size for the specific insert in the already limited range in Ion Torrent.
Comment
-
Originally posted by Retro View PostOK, just to answer to myself, even when P1 primer is used, the primer B and "TCAG key sequence" are present at the ends of the reads. They must be present on the beads.
P1 and A are the current sequences.
Comment
-
To SeAA:
You are right, P1 and A are the current sequences. Previous version of Ion Torrent amplicon method had primers A and B. Since my original question , we performed the sequencing with A-P1 amplicons. In reads that are long enough, the 3' end contains the P1 primer, followed by the TCAG key sequence and B primer sequence. That probably means that the beads contain B sequence with the TCAG key. Notice that the new version of the Ion Torrent protocol does not have the key sequence in the P1 primer, it did have it in the previous version with the B primer. For some reason they decided to switch the way the 3' end is amplified.
It is also interesting that all these primers are from other NGS technologies, A and B is from 454 and P1 from some other, not sure now. Probably to make it easier for users to switch to Ion Torrent, which is what we did from 454.
Comment
Latest Articles
Collapse
-
by seqadmin
Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...-
Channel: Articles
04-04-2024, 04:25 PM -
-
by seqadmin
Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...-
Channel: Articles
03-22-2024, 06:39 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, 04-11-2024, 12:08 PM
|
0 responses
30 views
0 likes
|
Last Post
by seqadmin
04-11-2024, 12:08 PM
|
||
Started by seqadmin, 04-10-2024, 10:19 PM
|
0 responses
32 views
0 likes
|
Last Post
by seqadmin
04-10-2024, 10:19 PM
|
||
Started by seqadmin, 04-10-2024, 09:21 AM
|
0 responses
28 views
0 likes
|
Last Post
by seqadmin
04-10-2024, 09:21 AM
|
||
Started by seqadmin, 04-04-2024, 09:00 AM
|
0 responses
52 views
0 likes
|
Last Post
by seqadmin
04-04-2024, 09:00 AM
|
Comment