Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Yet Another bwa mem unique post

    So, I am using the following version of BWA

    Program: bwa (alignment via Burrows-Wheeler transformation)
    Version: 0.7.12-r1039</pre>

    I got through a lot threads read answers and so on... still I am confused.

    this is the command I am using:
    Code:
    bwa mem -t 8 -M -k 19 -r 1 -c 1 $ref_genome $1/$base1&quot;.trimmed&quot; &gt; $3/$NOEX

    and those are the explanation for every string I included:
    #-c keep those that have unique alignment (Discard a MEM if it has more than INT occurence in the genome. This is an insensitive parameter. [10000])
    #-r by reducing it to 1, I get bwa mem to work things out more intensively, like the --best command for bowtie (Larger value yields fewer seeds, which leads to faster alignment speed but lower accuracy)
    #-k seed length (I thing that 32 is to big????)
    #-M keep it compatible with picard tools
    #-t threads to use
    What are your opinion on the -c and -r strings?

    then I get to see the produced file and it has sequences that are marked with the optional field of XA:Z and SA:Z

    XA: Alternative hits; format: (chr,pos,CIGAR,NM* in anny case I have failed to find the XT:A:U optional flag

    SA: Z, not sure what it is but, it almost always coincide with the 256 flag = not primary alignment so I believe that this is NOT a unique aligned read.

    The question is mostly on XA:. there is no XA:U if it exist it is XA:Z and is followed by 3 or more genomic coordinates, and that makes me believe that this is not a uniquely mapped read.

    To wrap it up I remove from the SAM filewith the following:
    Code:
    samtools view -h -q 1 -F 4 -F 256 $3/$NOEXT1.sam | grep -v "XA:Z" | grep -v "SA:Z" > $3/$NOEXT1_mem.sam;
    -F 4 : remove not mapped
    -F 256 : remove not primary aligned
    -q 1: remove reads with MAPQ quality less than 1 (I thing that this is quite necessary)

    QUESTION: Am, I missing something, Do I do something wrong?


    here are some reads as an example:

    those include both the SA: and the XA optional flag


    Code:
    BIOMICS-HISEQHI:522:HCYM5ADXX:2:2115:14837:88360        16      chr12   87311997        1       34M17S  *       0       0       TCTATAAACACCTCTAAGAAAATAAACTAGAAAATCCAGATGAAATGGATA     BBBBBBABB&gt;A&lt;B&gt;B&gt;A?7BBB?A=0BBA?A?BBBBBBBA=BBBBBBBB?B     NM:i:1  MD:Z:0A33       AS:i:33 XS:i:31 SA:Z:chr2,161581931,+,32M19S,1,0;       XA:Z:chr9,-104599379,51M,5;chr3,+170653467,51M,5;
    BIOMICS-HISEQHI:522:HCYM5ADXX:2:1102:3525:68438 16      chr12   87311999        0       32M17S  *       0       0       TATAAACACCTCTAAGAAAATAAACTAGAAAATCCAGATGAAATGGATA       AA==5.DB8BB8=/??*&lt;D99D??9?D&lt;BEBD@FDD????E&lt;E?E&lt;CAC       NM:i:0  MD:Z:32 AS:i:32 XS:i:30 SA:Z:chr2,161581931,+,32M17S,0,0;       XA:Z:chr9,-104599381,49M,4;chr3,+170653467,49M,4;chr12,+46991828,49M,5;
    BIOMICS-HISEQHI:522:HCYM5ADXX:2:1209:6904:71888 256     chr17   59076122        0       33M18H  *       0       0       TTTTCCCATTCTGTAGATTGTCTGTTTACTCTG       IGGIIIIIIIIGA@GGGHFIIIIIFFHEIHIHF       NM:i:0  MD:Z:33 AS:i:33 XS:i:32 SA:Z:chr11,22585338,+,18S33M,0,0;       XA:Z:chr4,-151801895,19S32M,0;
    those got only the XA: optional flag
    Code:
    BIOMICS-HISEQHI:522:HCYM5ADXX:2:2104:11639:55952        0       chr1    8120580 1       15S31M5S        *       0       0       TCTTGGGATGGACATGTGAGCTGAAATGGCGCCATTGCACTCCAGCTTGGG     GIIIGCGFGCGHEGFHIICCGIHDD&gt;HB&lt;CHHGAHHIIHHEHHFFFFFEDD     NM:i:0  MD:Z:31 AS:i:31 XS:i:29 XA:Z:chr8,+98304845,30M21S,1;chr20,+51943978,23S28M,0;chr16,+70407077,14S37M,2;chr8,+55962122,15S36M,2;chrX,-70173856,26M25S,0;
    BIOMICS-HISEQHI:522:HCYM5ADXX:2:2105:16548:32340        0       chr1    8120580 6       15S34M  *       0       0       CCTTGGGATGGACATGTGAGCTGAAATGGCGCCATTGCACTCCAGCCTG       HHIIHIEIBF1?DHGGDDDF&lt;FB?BGIHI&gt;FGI&lt;EHC@CCHEFE&gt;@BCC       NM:i:0  MD:Z:34 AS:i:34 XS:i:30 XA:Z:chr8,+98304845,30M19S,0;chr16,+70407077,14S35M,1;chr8,+55962122,15S34M,1;
    BIOMICS-HISEQHI:522:HCYM5ADXX:2:2106:5931:90491 0       chr1    8120580 6       14S32M  *       0       0       CTTGGGATGTACATGTGAGCTGAAATGGCGCCATTGCACTCCAGCC  @H4EC381)*1*:?B:*?:0:?BD?G*?8'-&lt;-5C4=;;D.?7A&gt;E  NM:i:0  MD:Z:32 AS:i:32 XS:i:28 XA:Z:chr16,+70407077,13S33M,1;chr8,+55962122,14S32M,1;
    BIOMICS-HISEQHI:522:HCYM5ADXX:2:2108:7261:70911 0       chr1    8120580 0       15S36M  *       0       0       TCTTGGGATGGACATGTGAGCTGAAATGGCGCCATTGCACTCCAGTCTGGG     :&gt;33@@1(.=?1&gt;99?3.=33.6=3:&gt;)=;533-5=9;;3&gt;9?;?8=?337     NM:i:2  MD:Z:30C3A1     AS:i:30 XS:i:29 XA:Z:chr8,+98304845,30M21S,1;chr1,-8936944,28M23S,0;chr16,+70407077,14S37M,2;chr8,+55962122,15S36M,2;chr10,-95309935,26M25S,0;
    BIOMICS-HISEQHI:522:HCYM5ADXX:2:2113:12753:98209        0       chr1    8120580 9       15S36M  *       0       0       CCTTGGGATGGACATGTGAGCTGAAATGGCGCCATTGCACTCCAGCCTGAG     &gt;&lt;6)&lt;2:86-97;3:?&gt;?==&lt;?&gt;?1=?3&gt;75;?3=?;?;=???;?==&gt;7;&gt;     NM:i:0  MD:Z:36 AS:i:36 XS:i:30 XA:Z:chr8,+98304845,30M21S,0;chr16,+70407077,14S37M,2
    Any help would be appreciated

Latest Articles

Collapse

  • seqadmin
    Strategies for Sequencing Challenging Samples
    by seqadmin


    Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
    03-22-2024, 06:39 AM
  • seqadmin
    Techniques and Challenges in Conservation Genomics
    by seqadmin



    The field of conservation genomics centers on applying genomics technologies in support of conservation efforts and the preservation of biodiversity. This article features interviews with two researchers who showcase their innovative work and highlight the current state and future of conservation genomics.

    Avian Conservation
    Matthew DeSaix, a recent doctoral graduate from Kristen Ruegg’s lab at The University of Colorado, shared that most of his research...
    03-08-2024, 10:41 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 03-27-2024, 06:37 PM
0 responses
13 views
0 likes
Last Post seqadmin  
Started by seqadmin, 03-27-2024, 06:07 PM
0 responses
11 views
0 likes
Last Post seqadmin  
Started by seqadmin, 03-22-2024, 10:03 AM
0 responses
53 views
0 likes
Last Post seqadmin  
Started by seqadmin, 03-21-2024, 07:32 AM
0 responses
69 views
0 likes
Last Post seqadmin  
Working...
X