SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Custom primer failed kal33na Illumina/Solexa 1 04-22-2013 01:39 PM
Validation of Custom Sequencing Primer Akira Illumina/Solexa 1 11-05-2012 09:22 AM
50+% of my HiSEQ reads are 3' primer (custom primer used) ZAAB Sample Prep / Library Generation 3 02-06-2012 11:00 AM
Can smRNA sequencing primer and genomic DNA sequencing primer mixed in one lane? whimsy Illumina/Solexa 3 04-06-2011 09:30 AM
custom primer menglv Illumina/Solexa 3 01-18-2011 01:01 PM

Reply
 
Thread Tools
Old 04-13-2013, 11:04 AM   #21
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,168
Default

Quote:
Originally Posted by NWBiotech View Post
I am using custom primers on a low complexity library. I used positions 18, 19 and 20 to put in the primers. Will the system read the PhiX clones (i.e. are the standard primers mixed into the run mix) or do I need to mix my custom primers into a different position on the block?
To sequnce clusters with custom primers and standard TruSeq primers (e.g PhiX control) you have to mix all the primers for each read together. You do this by adding your custom primers into the reagent location containg the standard primers. The MiSeq documentation and your FAS can help you with the neccessary volumes/concentrations.
kmcarr is offline   Reply With Quote
Old 05-18-2013, 12:05 AM   #22
Ktu
Junior Member
 
Location: paris

Join Date: Apr 2013
Posts: 7
Default

Good morning,

I'm currently using Nextera XT for my transposons' library. However during the PCR amplification, I'm using one custom primer and the primer P7 from the kit in order to select all the fragments with the transposon insertions sites.


Here are the sequence of the primers used during the amplification:

Custom primer amplification forward: 5' AATGATACGGCGACCACCGAGCATGCAAGCTTCAGGGTTGAGATGTG3'

LENGTH:47 GC CONTENT:53.2 %MELT TEMP:70.5 C

P7 Primer amplification reverse: 5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG 3'

Then i follow the differents steps of the Nextera XT DNA sample preparation guide


For the sequencing, i also design a custom sequencing primer for the read 1 which recognize the sequence of the transposon.

Here is the sequence of my custom primer sequencing:

Primer Sequencing: CCGAGCATGCAAGCTTCAGGGTTGAGATGTGTA

LENGTH:33GC CONTENT:51.5 %MELT TEMP:65.6 C

My problem: The results after the run (50 cycles single read)are completely wrong. I don't have right sequences. For example i get only a read of A or C. Although, the index read are perfect. So i think my sequence primer is wrong but i don't understand why. I respect the length, GC content and the melt temperature.

Questions : Are my custom primers correct? Are there others properties for the custom primer?

Thanking you in anticipation,
Ktu is offline   Reply With Quote
Old 05-20-2013, 10:48 AM   #23
kcchan
Senior Member
 
Location: USA

Join Date: Jul 2012
Posts: 182
Default

Hi Ktu,

I'm curious as to why you chose to use Nextera in conjunction with your own PCR primers. Wouldn't it have been simpler to just make an amplicon library instead?

Anyway, I think the problem you're facing is that the primer sequences are incorrect. The P5 adapter sequence is wrong at one of the bases. Furthermore, your sequencing primer bleeds into the P5 adapter and has two extra bases than your PCR primer. Those factors could have been enough to mess up the hybridization conditions for the primer and result in poor sequencing. I would suggest re-designing your PCR primers so that it uses correct P5 adapter sequence and 7 bases worth of padding before your primer sequence. You'll also have to shift your sequencing primers so that it doesn't overlap the P5 adapter sequence. You can use the padding region if you need some more bases to get the Tm to around 65C if necessary.
kcchan is offline   Reply With Quote
Old 05-21-2013, 01:54 AM   #24
Ktu
Junior Member
 
Location: paris

Join Date: Apr 2013
Posts: 7
Default

Quote:
Originally Posted by kcchan View Post
Hi Ktu,

I'm curious as to why you chose to use Nextera in conjunction with your own PCR primers. Wouldn't it have been simpler to just make an amplicon library instead?

Anyway, I think the problem you're facing is that the primer sequences are incorrect. The P5 adapter sequence is wrong at one of the bases. Furthermore, your sequencing primer bleeds into the P5 adapter and has two extra bases than your PCR primer. Those factors could have been enough to mess up the hybridization conditions for the primer and result in poor sequencing. I would suggest re-designing your PCR primers so that it uses correct P5 adapter sequence and 7 bases worth of padding before your primer sequence. You'll also have to shift your sequencing primers so that it doesn't overlap the P5 adapter sequence. You can use the padding region if you need some more bases to get the Tm to around 65C if necessary.
Hi,

Thank you for your answer.

I'm using nextera because it is faster to make a library.

When i do the amplification PCR. i'm not using the primer P5 given by the kit. So i don't have the P5 adapter.I am only using my custom primer for the amplification so i can select all the fragments with the insertion site of the transposon.
At the end, i have 1)the sequence for clusters (AATGATACGGCGACCACCGA) 2) the insertion site (GCATGCAAGCTTCAGGGTTGAGATGTG ) 3)ADN that i want to sequence 4) index 5) P7 adaptor.

The sequencing primer has 2 more bases corresponding to the 2 next bases of the transposon sequence. It was added just for the Tm and the %GC.This primer recognizes the insertion site (2).
I dont understand how it can interact with the P5 adaptor because my sequencing primer has the same sequence than the sequence used is PCR (2)
Ktu is offline   Reply With Quote
Old 05-22-2013, 11:18 AM   #25
lotijeo
Junior Member
 
Location: Oregon

Join Date: Apr 2013
Posts: 3
Default

Hi Ktu,
Are you using a 2-step PCR approach, where you append Read 1/2 sequences along with the transposome sequence to your locus gene primer, and then during the 2nd PCR you use the NExtera index kit to add sequencing adapters (P5/P7 seqeunces+indexes) to your samples?
How is the complexity of your sample? If it's low, you might need to add some Ns between your primer and the transposome sequences to increase the complexity of your sample. My plan is to do 2 PCR rounds:
PCR1: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[gene specific primer]-3' + 5'-GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG-[gene specific primer]-3'
PCR2: Nextera kit where PCR primer1-{i5}-5'-Adapter + PCR primer 2-{i7}-3'-Adapter
Did you get positive unique bands on gels?
I'd be curious to know what went wrong with your run...
lotijeo is offline   Reply With Quote
Old 05-22-2013, 11:46 PM   #26
Ktu
Junior Member
 
Location: paris

Join Date: Apr 2013
Posts: 7
Default

Quote:
Originally Posted by lotijeo View Post
Hi Ktu,
Are you using a 2-step PCR approach, where you append Read 1/2 sequences along with the transposome sequence to your locus gene primer, and then during the 2nd PCR you use the NExtera index kit to add sequencing adapters (P5/P7 seqeunces+indexes) to your samples?
How is the complexity of your sample? If it's low, you might need to add some Ns between your primer and the transposome sequences to increase the complexity of your sample. My plan is to do 2 PCR rounds:
PCR1: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[gene specific primer]-3' + 5'-GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG-[gene specific primer]-3'
PCR2: Nextera kit where PCR primer1-{i5}-5'-Adapter + PCR primer 2-{i7}-3'-Adapter
Did you get positive unique bands on gels?
I'd be curious to know what went wrong with your run...
Hi,

Actually i did in parallel two experience:
1) Two PCR(12+12 cycles):
a- PCR with the kit index to increase the fragments' number that i call PCR index. Using P5/P7 primers. I got for this experience only one band
b- PCR with my custom primer with the clustering primer-my gene specific primer and P7 primer that i call PCR selection
So i have AATGATACGGCGACCACCGAGCATGCAAGCTTCAGGGTTGAGATGTGDNAINDEX P7

I got for this experience a smire in agarose gel. It is normal because i target my gene which is cut randomly during the tagmentation step. Meaning that the sequence that i target can be at the beginning, the middle or the end of the fragment.

2) One PCR (30 cycles):
- PCR selection : custom primer + P7 primer

I don't need to do a PCR index because i am sequencing with a specific primer who recognizes my gene GCATGCAAGCTTCAGGGTTGAGATGTG and not P5.
My sequencing primer is like this: CCGAGCATGCAAGCTTCAGGGTTGAGATGTGTA
I add two nucleotide TA at 3' end because of the TM and i overlap the clustering primer. I think the problem is here.

Quote:
Originally Posted by lotijeo View Post
PCR1: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[gene specific primer]-3' + 5'-GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG-[gene specific primer]-3'
If i use these primers, i'm afraid that there will be competition between transposase sequence TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG and my gene specific primer. Because the transposase sequence correspond to the first nucleotides and my gene like i said above can be anywhere.
The gene sequence is not directly next to the transposase sequence.
Ktu is offline   Reply With Quote
Old 05-30-2013, 12:01 AM   #27
kinurev
Junior Member
 
Location: Australia

Join Date: May 2013
Posts: 2
Default

Hi Ktu,

I think your problem is the low complexity of your library. From what you describe, I guess your custom sequencing primer was designed such that it will sequence a bit of your transposon end then continue to sequence the DNA insertion site.

Sequencing primer: CCGAGCATGCAAGCTTCAGGGTTGAGATGTGTA
Transposon sequence: CCGAGCATGCAAGCTTCAGGGTTGAGATGTGTA taagagacagctg
(I use TnLoxp53 sequence as an example here)

This means that all reads of your library begin with "taagagacagctg" which creates huge problem with the software trying to identify clusters for base calling. Have you considered using a mix of sequencing primers to increase the complexity of your library?
kinurev is offline   Reply With Quote
Old 05-30-2013, 03:39 AM   #28
Ktu
Junior Member
 
Location: paris

Join Date: Apr 2013
Posts: 7
Default

Quote:
Originally Posted by kinurev View Post
This means that all reads of your library begin with "taagagacagctg" which creates huge problem with the software trying to identify clusters for base calling. Have you considered using a mix of sequencing primers to increase the complexity of your library?
Hi,

It is exactly what i want to do. But i don't understand what is the probleme with the software.
I am working on two differents transposon so i have two sequencing primers.
Ktu is offline   Reply With Quote
Old 05-30-2013, 04:06 AM   #29
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,315
Default

Quote:
Originally Posted by kinurev View Post
Hi Ktu,

I think your problem is the low complexity of your library. From what you describe, I guess your custom sequencing primer was designed such that it will sequence a bit of your transposon end then continue to sequence the DNA insertion site.

Sequencing primer: CCGAGCATGCAAGCTTCAGGGTTGAGATGTGTA
Transposon sequence: CCGAGCATGCAAGCTTCAGGGTTGAGATGTGTA taagagacagctg
(I use TnLoxp53 sequence as an example here)

This means that all reads of your library begin with "taagagacagctg" which creates huge problem with the software trying to identify clusters for base calling.
This is no longer the case for the MiSeq. The v2.2 MCS software has completely solved this instrument issue. You just need to spike in 5% or more of a high complexity library. That's it. Problem solved.

Of course, there is now a year or more worth of manuals, publications and word of mouth telling us and providing many sorts of insane work arounds to what always was an instrument/software issue. So it will take some time for the word to get out that these are not necessary for the MiSeq.

Are they necessary for any Illumina sequencer? Well, most of the issues caused by "the issue" we are discussing are said to go away if one uses a control lane on a flow cell. So, maybe not?

--
Phillip
pmiguel is offline   Reply With Quote
Old 05-30-2013, 01:17 PM   #30
dcnadler
Junior Member
 
Location: Bay Area

Join Date: May 2013
Posts: 3
Default

Quote:
Originally Posted by pmiguel View Post
This is no longer the case for the MiSeq. The v2.2 MCS software has completely solved this instrument issue. You just need to spike in 5% or more of a high complexity library. That's it. Problem solved.

Of course, there is now a year or more worth of manuals, publications and word of mouth telling us and providing many sorts of insane work arounds to what always was an instrument/software issue. So it will take some time for the word to get out that these are not necessary for the MiSeq.

Are they necessary for any Illumina sequencer? Well, most of the issues caused by "the issue" we are discussing are said to go away if one uses a control lane on a flow cell. So, maybe not?

--
Phillip
Can you give a little more detail on the software changes that improve runs with low-complexity libraries (assuming you spike in >= 5% high-complexity DNA)? Or point to the thread that discusses this change?

Based on the software release notes, I am guessing it has something to do with the color matrix estimation method changing? But I do not have enough expertise on these methods to be sure.

thanks!
dcnadler is offline   Reply With Quote
Old 05-30-2013, 08:33 PM   #31
kinurev
Junior Member
 
Location: Australia

Join Date: May 2013
Posts: 2
Default

pmiguel, do you think spike in with 5% PhiX library works for Ktu application because he is using a custom sequencing primer which will not sequence from the PhiX library. The effect of PhiX spike-in in this case is just lower the cluster density his transposon library.

Besides, if you still have to spike-in >5% of high complexity library or run a control lane then "the issue" is not completely solved, is it?

Cheers,
kinurev is offline   Reply With Quote
Old 05-31-2013, 03:00 AM   #32
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978
Default

Quote:
Originally Posted by dcnadler View Post
Can you give a little more detail on the software changes that improve runs with low-complexity libraries (assuming you spike in >= 5% high-complexity DNA)? Or point to the thread that discusses this change?

Based on the software release notes, I am guessing it has something to do with the color matrix estimation method changing? But I do not have enough expertise on these methods to be sure.

thanks!
Here is the tech note from Illumina about this topic: http://www.illumina.com/documents/pr...ersity_RTA.pdf
GenoMax is offline   Reply With Quote
Old 05-31-2013, 03:28 AM   #33
Ktu
Junior Member
 
Location: paris

Join Date: Apr 2013
Posts: 7
Default

Quote:
Originally Posted by kinurev View Post
pmiguel, do you think spike in with 5% PhiX library works for Ktu application because he is using a custom sequencing primer which will not sequence from the PhiX library. The effect of PhiX spike-in in this case is just lower the cluster density his transposon library.

Besides, if you still have to spike-in >5% of high complexity library or run a control lane then "the issue" is not completely solved, is it?

Cheers,
Hi kinurev,

In the case of nextera XT, you don't need the PhiX.
i don't understand what is the complexity library concretely.
Ktu is offline   Reply With Quote
Old 05-31-2013, 11:09 AM   #34
dcnadler
Junior Member
 
Location: Bay Area

Join Date: May 2013
Posts: 3
Default

Quote:
Originally Posted by GenoMax View Post
Here is the tech note from Illumina about this topic: http://www.illumina.com/documents/pr...ersity_RTA.pdf
Thank you! This is exactly what I was looking for.
dcnadler is offline   Reply With Quote
Old 07-05-2013, 10:22 AM   #35
charel
Junior Member
 
Location: UK

Join Date: Dec 2012
Posts: 2
Default custom sequencing primer design

Good evening,

I have posted a question a little while back in this thread concerning Tm of custom sequencing primers.

Now coming back to the issue, I am still battling with their design, especially as I can not explain how the Illumina or the Fluidigm sequencing primers work considering their Tm (see attached table no 1-4). IDT's OligoAnalyzer seems to predict a Tm for these sequences much lower than what is recommended in this thread, i.e. >70C; especially the Fluidigm primers are a puzzle to me. As Fluidigm is using LNA bases I have also checked the Tm on the Exiqon website (provider of LNA oligos) and for the same sequences I see much higher values. I believe that this can be explained by the fact that Exiqon uses an Na+ concentration of 115 mM as opposed to IDT with only 50 mM. What salt concentration do we have in the HT1 buffer? In other words what Tm predictor is relevant here?

Taking these observations to the design of my sequencing primers (also in the attached table no 5-7 and pasted below) I wonder what option is best. I am now considering to spike them in including some LNA bases. Where should I put them? How many? In the Fluidigm primers they are a the 5' end; Why? As an alternative to LNA I have designed number 7, a longer version of number 5, I have just extended it into the P5 adapter region. Is that a feasible approach? Which design would you go for and/or what modifications would you suggest, or should I just give it a try?

>Mine forward short (no.5)
CACGCTCGAGGAAAGAAAAATATAGGCGCGCCA
>Mine reverse (no.6)
GAGTCAGCAGCGAATTGGAGCTCTAGCTACCTA
>Mine forward long (no.7)
TACGGCGACCACCGAGGCACGCTCGAGGAAAGAAAAATATAGGCGCGCCA


Many thanks,

Charles.
Attached Images
File Type: png primer_designs.png (140.8 KB, 39 views)
charel is offline   Reply With Quote
Old 07-08-2013, 05:08 AM   #36
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,315
Default

You would need to account for the LNA bases in your Tm calculations for the Fluidigm primers. They probably put the LNA bases near the 3' end because, to a first approximation, those are the critical bases for the polymerase. If they anneal, the polymerase can extend. If they don't anneal the polymerase will have difficulty extending.

I don't know what the salt concentration in HT1 is. ECO would probably know.

The main trick, I think, in this case is that there is basically no down side to making the primers as long as possible. Remember this is surface-bound PCR/primer extension. Many of the issues with getting exactly the right Tm have to do with specificity. But since the surface-bound nature of these reactions nearly eliminates template competition, I don't see a problem with just going as long as possible.

--
Phillip
pmiguel is offline   Reply With Quote
Old 09-27-2013, 07:20 AM   #37
TonyBrooks
Senior Member
 
Location: London

Join Date: Jun 2009
Posts: 298
Default

We've done a couple of runs now with a custom primer and got poor results - very dim clusters. We believe the first run had a read primer with Tm that was too low (60C by OligoAnalyzer) so we redesigned by adding some additional P5 bases onto the 5' end and raising Tm to ~66C and ran the same library again with the same result.
We spike the custom primer into the read 1 mix (low diversity library, so 5% PhiX is spiked in). The PhiX clusters are perfect. Has anyone seen this?
We were wondering whether to increase the concentration of the custom primer from the recommended amount, or maybe running the custom primer on its own and hoping for enough diversity (at least we can check whether we have decent first cycle intensity).
It's times like this I actually miss the GAIIx (shock, horror!!). At least you could run one cycle and play with primer-rehybs until you got it right.
TonyBrooks is offline   Reply With Quote
Old 09-30-2013, 03:36 AM   #38
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,315
Default

Hi Tony,
I don't think there is any downside to making your primers longer than necessary. It isn't like you are trying to distinguish between slightly different sequences with them.

--
Phillip
pmiguel is offline   Reply With Quote
Old 07-16-2014, 12:40 AM   #39
RCJK
Senior Member
 
Location: Australia

Join Date: May 2009
Posts: 155
Default

Hi Tony,
I know it's been a while, but have you been able to resolve your issue with the dim clusters? If so, what did you do to resolve the issue?
Thanks!
RCJK is offline   Reply With Quote
Old 07-16-2014, 01:24 AM   #40
TonyBrooks
Senior Member
 
Location: London

Join Date: Jun 2009
Posts: 298
Default

Yes, although we needed to redesign the assay to use a different priming site.
TonyBrooks is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:02 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO