Hi all
We're looking to make some standard genomic rapid libraries for 454 sequencing.
We've sucessfully used the NEBNext rapid library kit with the Roche RL-MID set, but we need to make non-MID adapters for some standard gDNA libraries. I wondered if anyone has tried making home-made adapters.
I'm assuming they'll be the same sequences as the extended MID set but without the 10 base index. Going by the sequences on the IDT site, that would be;
With MID (index in square brackets)
5FAMC*C*A*T*CTCATCCCTGCGTGTCTCCGACGACT[AGACTC-G*A*C*G]*T3
..............................|||||||| ||||||.|.|.|.|
3G*G*A*T*AGGGGACACACGGAACTCTCTGCIGCTGI[TCTGIG*C*T*G*C](phos)5
Without MID
5FAMC*C*A*T*CTCATCCCTGCGTGTCTCCGACGACT*T3
..............................||||||||
3G*G*A*T*AGGGGACACACGGAACTCTCTGCIGCTGI(phos)5
I'm not worried about including the FAM as we don't quantify by flourescence
So my questions are;
Are the inosines, really necessary?
Are the phosphorothioates necessary on the adapter tails? We don't have them on our Illumina homebrew adapters, just the one preceeding the T overhang.
Are 8 complementary bases enough to anneal into a Y-adapter?
I would appreciate it if anyone could share the adapter sequences they use.
Tony
We're looking to make some standard genomic rapid libraries for 454 sequencing.
We've sucessfully used the NEBNext rapid library kit with the Roche RL-MID set, but we need to make non-MID adapters for some standard gDNA libraries. I wondered if anyone has tried making home-made adapters.
I'm assuming they'll be the same sequences as the extended MID set but without the 10 base index. Going by the sequences on the IDT site, that would be;
With MID (index in square brackets)
5FAMC*C*A*T*CTCATCCCTGCGTGTCTCCGACGACT[AGACTC-G*A*C*G]*T3
..............................|||||||| ||||||.|.|.|.|
3G*G*A*T*AGGGGACACACGGAACTCTCTGCIGCTGI[TCTGIG*C*T*G*C](phos)5
Without MID
5FAMC*C*A*T*CTCATCCCTGCGTGTCTCCGACGACT*T3
..............................||||||||
3G*G*A*T*AGGGGACACACGGAACTCTCTGCIGCTGI(phos)5
I'm not worried about including the FAM as we don't quantify by flourescence
So my questions are;
Are the inosines, really necessary?
Are the phosphorothioates necessary on the adapter tails? We don't have them on our Illumina homebrew adapters, just the one preceeding the T overhang.
Are 8 complementary bases enough to anneal into a Y-adapter?
I would appreciate it if anyone could share the adapter sequences they use.
Tony
Comment