SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
454 Rapid Library adaptors for NEBNExt protocol Coyk Sample Prep / Library Generation 1 02-18-2012 06:49 PM
Rapid Library Library Quantitation using concentration not RFU GraemeFox 454 Pyrosequencing 9 10-20-2011 11:27 PM
Rapid Library Prep 454 HELP, HELP, HELP!!! Giancarlo Sample Prep / Library Generation 0 09-01-2011 08:34 AM
Rapid Library Kit contents lhandley 454 Pyrosequencing 2 05-03-2010 11:34 AM
Difference between 454 pair end library and 454 standard library edge 454 Pyrosequencing 1 09-30-2009 01:08 AM

Reply
 
Thread Tools
Old 08-01-2011, 08:45 AM   #1
TonyBrooks
Senior Member
 
Location: London

Join Date: Jun 2009
Posts: 298
Default NEBNext 454 rapid library

Hi all
We're looking to make some standard genomic rapid libraries for 454 sequencing.
We've sucessfully used the NEBNext rapid library kit with the Roche RL-MID set, but we need to make non-MID adapters for some standard gDNA libraries. I wondered if anyone has tried making home-made adapters.
I'm assuming they'll be the same sequences as the extended MID set but without the 10 base index. Going by the sequences on the IDT site, that would be;

With MID (index in square brackets)

5FAMC*C*A*T*CTCATCCCTGCGTGTCTCCGACGACT[AGACTC-G*A*C*G]*T3
..............................|||||||| ||||||.|.|.|.|
3G*G*A*T*AGGGGACACACGGAACTCTCTGCIGCTGI[TCTGIG*C*T*G*C](phos)5


Without MID

5FAMC*C*A*T*CTCATCCCTGCGTGTCTCCGACGACT*T3
..............................||||||||
3G*G*A*T*AGGGGACACACGGAACTCTCTGCIGCTGI(phos)5


I'm not worried about including the FAM as we don't quantify by flourescence
So my questions are;
Are the inosines, really necessary?
Are the phosphorothioates necessary on the adapter tails? We don't have them on our Illumina homebrew adapters, just the one preceeding the T overhang.
Are 8 complementary bases enough to anneal into a Y-adapter?

I would appreciate it if anyone could share the adapter sequences they use.

Tony
TonyBrooks is offline   Reply With Quote
Old 08-01-2011, 12:56 PM   #2
zhengz
Member
 
Location: sweden

Join Date: Aug 2010
Posts: 23
Default

Just my personal views.

Are the inosines, really necessary?
-- Not necessary with the short stem.

Are the phosphorothioates necessary on the adapter tails? We don't have them on our Illumina homebrew adapters, just the one preceeding the T overhang.
-- It is known that phosphorothioates bonds help to prevent the ends (priming sites) from degradation. At high lib concentration, the difference between libs with and without such bonds might be too little to appreciate. At low lib conc., or near the level before feeding emPCR, the bonds might have noticeable effect on the reproducibility of enrichment% using this low conc. lib.

Are 8 complementary bases enough to anneal into a Y-adapter?
-- Yes, I think so. The annealing T might be somewhere around 40-50 C.
zhengz is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:42 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO