SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
BLAST+ creating custom blast database and using blast+ filtering features deniz Bioinformatics 3 07-07-2019 08:04 AM
Can't make Maq nightsun Bioinformatics 1 12-30-2011 08:24 PM
BLAST+ vs BLASTALL (legacy BLAST) Symphysodon Bioinformatics 4 10-25-2011 02:52 PM
Make Clean and Make all not working qnc Bioinformatics 27 10-21-2011 10:17 AM
BLAST database error - when changing to new BLAST+ local program biobio Bioinformatics 4 06-15-2011 05:20 AM

Reply
 
Thread Tools
Old 04-13-2012, 11:35 AM   #1
detq182
Member
 
Location: Colombia

Join Date: Feb 2012
Posts: 20
Smile Make my own blast DB

Hi everyone

I have a question about how to make my own BLASTdb using the result of my Ref-seq work before the annotation step, i mean not like this

>CL1Contig1
ACGGGGGAGGCACCATTATTTGGGCTGCAGACAACAAACTGAAATTCTGGCGGCCCGA

I want it like this with the annotation of the sequennce
>CL1Contig1 Nascent polypeptide associated complex alpha
ACGGGGGAGGCACCATTATTTGGGCTGCAGACAACAAACTGAAATTCTGGCGGCCCGA

Any script of bioperl that could help for my question? or any different solution.

Note: I known that i have to use format db or makeblastdb to meke the DB

Thanks you all
detq182 is offline   Reply With Quote
Old 04-14-2012, 03:43 AM   #2
detq182
Member
 
Location: Colombia

Join Date: Feb 2012
Posts: 20
Default Any sugestion

Please help me with that
detq182 is offline   Reply With Quote
Old 04-14-2012, 05:10 AM   #3
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,542
Default

It sounds like you are asking for help in generating a FASTA file with a useful description line (which you can then turn into a BLAST database). How are you making the FASTA file at the moment?
maubp is offline   Reply With Quote
Old 04-14-2012, 05:50 AM   #4
detq182
Member
 
Location: Colombia

Join Date: Feb 2012
Posts: 20
Default using perl

Im using a perl script but i cant get the original query (cDNA) insted im getting out the the protein query (blastx), i don want the protein sequence.

Code:
#!/usr/bin/perl  
use Bio::SearchIO;
$report_obj = new Bio::SearchIO(-format => 'blast',                                   
                                  -file   => 'C:\blast-2.2.25+\Lib3_consensus_dbUp.xml');   
while( $result = $report_obj->next_result ) {     
    while( $hit = $result->next_hit ) {       
      while( $hsp = $hit->next_hsp ) {
         if ( $hsp->evalue < 0.0001 ) {            
           print $result->query_name(),"\t",$hit->description(),"\n",$hsp->seq_str('query'),
           "\n";         
         }       
       }     
     }   
}
How can i put this simbol ">" before the query name?
detq182 is offline   Reply With Quote
Old 04-14-2012, 04:30 PM   #5
detq182
Member
 
Location: Colombia

Join Date: Feb 2012
Posts: 20
Default

anyone try to make a Db with the description+sequence?
detq182 is offline   Reply With Quote
Old 04-16-2012, 06:16 AM   #6
westerman
Rick Westerman
 
Location: Purdue University, Indiana, USA

Join Date: Jun 2008
Posts: 1,104
Default

Quote:
Originally Posted by detq182 View Post
anyone try to make a Db with the description+sequence?
Of course. Just not in the way you are doing it. It is the weekend. The question you are posing is both simple yet so specific to how you are approaching it that I do not think that anyone wanted to take the time over the weekend to try solving your problem. Especially when you post something like:

Quote:
How can i put this simbol ">" before the query name?
Ah. Did you even try a
Code:
print '>'
???? People generally help others who show some initiative in solving their own problems.
westerman is offline   Reply With Quote
Old 04-17-2012, 05:13 PM   #7
detq182
Member
 
Location: Colombia

Join Date: Feb 2012
Posts: 20
Post

Quote:
Originally Posted by westerman View Post
Of course. Just not in the way you are doing it. It is the weekend. The question you are posing is both simple yet so specific to how you are approaching it that I do not think that anyone wanted to take the time over the weekend to try solving your problem. Especially when you post something like:



Ah. Did you even try a
Code:
print '>'
???? People generally help others who show some initiative in solving their own problems.
Im sorry if i dont show some initiative in solving my problem, im in finals on the college and i started just a few days ago learning "Unix and Perl Primer for Biologists", im new in this just 2 month doing some bioinformatics, if the question is stupid im really sorry, im just starting.

hope that we are OK.
detq182 is offline   Reply With Quote
Old 04-18-2012, 06:32 AM   #8
phoss
Member
 
Location: Beltsville, MD

Join Date: Aug 2011
Posts: 12
Default

Hi detq182,
Why not delimit your fasta header with a special character such as colon or vertical bar?
For example:
>header | supplemental-info

This way, you can embed many annotations adjacent to your fasta header.
If I'm not mistaken, EBI-GOA follows the above convention.
phoss is offline   Reply With Quote
Old 04-18-2012, 08:00 AM   #9
detq182
Member
 
Location: Colombia

Join Date: Feb 2012
Posts: 20
Default thanks

Im going to try that
detq182 is offline   Reply With Quote
Old 04-18-2012, 01:45 PM   #10
SES
Senior Member
 
Location: Vancouver, BC

Join Date: Mar 2010
Posts: 275
Default

Quote:
Originally Posted by detq182 View Post
Im using a perl script but i cant get the original query (cDNA) insted im getting out the the protein query (blastx), i don want the protein sequence.

Code:
#!/usr/bin/perl  
use Bio::SearchIO;
$report_obj = new Bio::SearchIO(-format => 'blast',                                   
                                  -file   => 'C:\blast-2.2.25+\Lib3_consensus_dbUp.xml');   
while( $result = $report_obj->next_result ) {     
    while( $hit = $result->next_hit ) {       
      while( $hsp = $hit->next_hsp ) {
         if ( $hsp->evalue < 0.0001 ) {            
           print $result->query_name(),"\t",$hit->description(),"\n",$hsp->seq_str('query'),
           "\n";         
         }       
       }     
     }   
}
How can i put this simbol ">" before the query name?
This is a great start, but you will need to add a couple of steps if are trying to add annotations to your original fasta file of sequences. What I mean is that printing the HSP string for the query and hit will not be the entire sequence, just the part involved in the match. If you are only interested in the match part, then just add

Code:
">".
to the beginning of your print string (following the word "print" of course). Spaces outside of the quotes don't matter, but spaces inside the quotes are important. One more thing is that you will want to delimit your header with something other than a tab, as was previously suggested. That is as easy as replacing the "\t" in the print string with "|".
SES is offline   Reply With Quote
Reply

Tags
blast, blastdb, formatdb, perl

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:23 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO