SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Perl script mmmm Bioinformatics 3 01-17-2014 06:34 AM
Perl Script AdrianJ217 Bioinformatics 7 10-15-2012 04:58 AM
just perl script semna Bioinformatics 3 07-02-2011 08:42 AM
perl script bioenvisage Bioinformatics 5 02-01-2010 08:11 AM
Perl script bioenvisage Bioinformatics 4 01-28-2010 12:25 PM

Reply
 
Thread Tools
Old 01-22-2015, 11:24 AM   #1
codecatcher
Junior Member
 
Location: California

Join Date: Jan 2015
Posts: 2
Default Help with a simple script in PERL

sounds like homework

Last edited by codecatcher; 01-23-2015 at 02:12 PM.
codecatcher is offline   Reply With Quote
Old 01-22-2015, 11:31 AM   #2
Richard Finney
Senior Member
 
Location: bethesda

Join Date: Feb 2009
Posts: 700
Default

What does your first draft look like?
Richard Finney is offline   Reply With Quote
Old 01-22-2015, 11:52 AM   #3
Phoenix_ICE
Member
 
Location: UK

Join Date: Jan 2011
Posts: 13
Default

It sounds easy. But I really have no idea about the score! How to calculate the score?
Which one is the most important, and which one is the second, of your 3 limitations

Last edited by Phoenix_ICE; 01-22-2015 at 11:54 AM.
Phoenix_ICE is offline   Reply With Quote
Old 01-22-2015, 12:27 PM   #4
Bukowski
Senior Member
 
Location: Aberdeen, Scotland

Join Date: Jan 2010
Posts: 388
Default

Perl is not an acronym and therefore never capitalised. Show some working, or try your luck on stackoverflow.com.
Bukowski is offline   Reply With Quote
Old 01-22-2015, 12:53 PM   #5
rdeborja
Member
 
Location: Toronto

Join Date: Aug 2008
Posts: 42
Default A quick starting point

Here's a starting point for you. I copied the 23mer you provided 3 times with a slight modification to the first occurrence.

=== script.pl ======
Code:
#!/usr/bin/env perl
use Data::Dumper;

my $sequence = 'ACGATCTTTGCCCCGACGTGATCGAGGTTTTTTTTTTTTTTCAGAGACCGAGATACGATCCCCCGACGTGATCGAGGACGATCCCCCGACGTGATCGAGG';
my @sequences = $sequence =~ /.{21}GG/g;
print Dumper(\@sequences);

__END__
=== output =======
$ perl script.pl
$VAR1 = [
'TCTTTGCCCCGACGTGATCGAGG',
'ACGATCCCCCGACGTGATCGAGG',
'ACGATCCCCCGACGTGATCGAGG'
];

Last edited by rdeborja; 01-23-2015 at 04:19 AM.
rdeborja is offline   Reply With Quote
Old 01-22-2015, 02:45 PM   #6
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978
Default

@rdeborj: Please enclose your code in [CODE_] code here [/_CODE]. Remove the underscores when you use the tags.
GenoMax is offline   Reply With Quote
Old 01-22-2015, 03:01 PM   #7
codecatcher
Junior Member
 
Location: California

Join Date: Jan 2015
Posts: 2
Default

Thanks rdeborja and GenoMax for the comments. I will try it out and see if I can get it working with that.
Phoenix ICE I assume they are all equal parameters that need to be parsed if possible
codecatcher is offline   Reply With Quote
Old 01-22-2015, 10:57 PM   #8
sklages
Senior Member
 
Location: Berlin, DE

Join Date: May 2008
Posts: 628
Default

The above
Code:
/.{21}GG/g
won't catch overlapping 23mers. Just keep that in mind. E.g.:
Code:
$sequence = 'ACGATCTTTGCCCCGACGTGATCGAGGTTTGGTTGGTTTTTTTTTCAGAGACCGAGATACGATCCCCCGACGTGATCGAGGACGATCCCCCGACGTGATCGAGG';
sklages is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:19 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO