SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Empty sequence dictionary aquleaf Bioinformatics 2 01-14-2013 06:10 PM
The position file formats ".clocs" and "_pos.txt"? Ist there any difference? elgor Illumina/Solexa 0 06-27-2011 07:55 AM
what does "XT:M" in BWA output mean? orionzhou Genomic Resequencing 1 11-13-2010 07:27 PM
"Systems biology and administration" & "Genome generation: no engineering allowed" seb567 Bioinformatics 0 05-25-2010 12:19 PM

Reply
 
Thread Tools
Old 05-28-2010, 06:03 PM   #1
aiden
Junior Member
 
Location: Melbourne, Australia

Join Date: May 2010
Posts: 3
Default Bfast output and "Empty Sequence Dictionary" in .sam output

Hi there,
I've recently been struggling with the .sam output file from BFAST postprocess. My goal is to get this output into a .ace format. Anthony Fejes recently tweaked the ConvertToAce utility within the Vancouver Short Read Analysis Package to accept .sam input files. However, when the utility runs I get an output like this:

Code:
Line 950
Line: SRR026786.11209822        0       2010_05_14_New_Consensus_237-1  1130   255      23M4I9M *       0       0       TATCCACTGCACTCCACTCCACTGCCGCCGCTTCGT   IAIII;IFII+II>I)DAEI&>0+43$20*%2)*#"     PG:Z:bfast      AS:i:275        NM:i:9 NH:i:1   IH:i:1  HI:i:1  MD:Z:A7C14^GCCG1TA4A1   XA:i:3
Ignoring SAM validation error due to lenient parsing:
Error parsing text SAM file. Empty sequence dictionary.; File SRR026786_postprocess_nounmapped.sam;
When I used the ValidateSamFile utility from Picard to check my .sam file, I get an error output saying that all of the lines have an empty sequence dictionary.

The only processing that I've done to the .sam file between BFAST postprocess and the ConvertToAce utility is to remove unmapped reads using samtools view with the following options:

Code:
samtools view SRR026786_postprocess.sam -S -F 4 -o SRR026786_postprocess_nounmapped.sam
...Which makes me wonder why the Empty Sequence Dictionary error would occur unless there was some issue upstream in the work flow.

Has anyone else had any issues with Empty Sequence Dictionary in BFAST postprocess .sam output files? Can anyone think of a work around? I know that Picard has the CreateSequenceDictionary utility, but I'm not sure how I could use this to add a sequence dictionary to each aligned read in my .sam file.

Any ideas would be greatly appreciated.
Aiden
aiden is offline   Reply With Quote
Old 05-28-2010, 06:50 PM   #2
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

Quote:
Originally Posted by aiden View Post
Hi there,
I've recently been struggling with the .sam output file from BFAST postprocess. My goal is to get this output into a .ace format. Anthony Fejes recently tweaked the ConvertToAce utility within the Vancouver Short Read Analysis Package to accept .sam input files. However, when the utility runs I get an output like this:

Code:
Line 950
Line: SRR026786.11209822        0       2010_05_14_New_Consensus_237-1  1130   255      23M4I9M *       0       0       TATCCACTGCACTCCACTCCACTGCCGCCGCTTCGT   IAIII;IFII+II>I)DAEI&>0+43$20*%2)*#"     PG:Z:bfast      AS:i:275        NM:i:9 NH:i:1   IH:i:1  HI:i:1  MD:Z:A7C14^GCCG1TA4A1   XA:i:3
Ignoring SAM validation error due to lenient parsing:
Error parsing text SAM file. Empty sequence dictionary.; File SRR026786_postprocess_nounmapped.sam;
When I used the ValidateSamFile utility from Picard to check my .sam file, I get an error output saying that all of the lines have an empty sequence dictionary.

The only processing that I've done to the .sam file between BFAST postprocess and the ConvertToAce utility is to remove unmapped reads using samtools view with the following options:

Code:
samtools view SRR026786_postprocess.sam -S -F 4 -o SRR026786_postprocess_nounmapped.sam
...Which makes me wonder why the Empty Sequence Dictionary error would occur unless there was some issue upstream in the work flow.

Has anyone else had any issues with Empty Sequence Dictionary in BFAST postprocess .sam output files? Can anyone think of a work around? I know that Picard has the CreateSequenceDictionary utility, but I'm not sure how I could use this to add a sequence dictionary to each aligned read in my .sam file.

Any ideas would be greatly appreciated.
Aiden
Use the "-h" option with samtools view, otherwise the SAM header (with the sequence dictionary) will not be outputted by "samtools view".
nilshomer is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:12 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO