
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
Filtering bowtie2 output sam file by mismatch number ty23991 Bioinformatics 0 05-18-2015 09:46 AM
bowtie2 output, sam to bam conversion error. a_mt Bioinformatics 3 03-29-2015 01:23 AM
Sam to Bam issue after bowtie2 Trevaly Bioinformatics 4 08-05-2014 06:42 AM
Bowtie2 Sam output Derek-C Bioinformatics 3 11-13-2012 11:10 AM
Bowtie2 SAM output missing base quality scores Comosus Bioinformatics 2 09-09-2012 11:21 PM

Thread Tools
Old 01-13-2016, 06:29 AM   #1
Location: Spain

Join Date: Oct 2015
Posts: 10
Default SAM output from bowtie2


I have some data from RNAseq which I'm going to map using tophat, but because I don't know the inner mate distance I'm mapping using bowtie2 to get to know this inner distance between reads (I took a subset of 25000 reads from the original data).

The problem I'm having is related to the output, I find it little bit weird and I can't find the column with the inner mate distance (which should be the number 9). And by the way, I'm new into this data.

This is the bowtie2 line:
bowtie2 --sensitive  -x /local/Reference/Homo_sapiens/UCSC/hg19/Sequence/Bowtie2Index/genome -1 Panc042_PDAC_PRITUM_Px00__raw_RNAseq_R1_SUBSET25000.fastq  -2 Panc042_PDAC_PRITUM_Px00__raw_RNAseq_R2_SUBSET25000.fastq -S bowtie2_subset/Pan042_PDCA_PRITUM_Px00_raw_RNAseq_subset.sam &> bowtie2_subset/log_bowtie2.txt
25000 reads; of these:
  25000 (100.00%) were paired; of these:
    7297 (29.19%) aligned concordantly 0 times
    12786 (51.14%) aligned concordantly exactly 1 time
    4917 (19.67%) aligned concordantly >1 times
    7297 pairs aligned concordantly 0 times; of these:
      2039 (27.94%) aligned discordantly 1 time
    5258 pairs aligned 0 times concordantly or discordantly; of these:
      10516 mates make up the pairs; of these:
        5801 (55.16%) aligned 0 times
        3773 (35.88%) aligned exactly 1 time
        942 (8.96%) aligned >1 times
88.40% overall alignment rate
First two lanes of sam file

HWI-ST1391:130419:D22RGACXX:4:1101:1389:2058    83      chr7    115578630       42      75M     =       115578540       -165    GATACAAGCTAAGCCTGAGATAATTATTATACAATAAGGATTTACTATTTTTCTCCTTTTATCAGCATTAGGGTC     EFC=F@@8)88(?*BIIIIIGDG@GCFD?:0:***?C??:9??1?>GEEBAA3<+AEEDE<C<$
HWI-ST1391:130419:D22RGACXX:4:1101:1389:2058    163     chr7    115578540       42      75M     =       115578630       165     TCGGGCTTTAATGACTGTACCCAGAAGTTAGTAATTATTTTTCCATGTCAAACAATAAAATTATTTTAATTCTCC     1=:=+=@AFAA4CBE,<+<AEGC88AAFEC41:?C<9:C:DGEII4?*009BG;D/9B>>==B$

runnerBio88 is offline   Reply With Quote
Old 01-13-2016, 08:44 AM   #2
Senior Member
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978

If you are only running bowtie2 to estimate insert size then you could use BBMerge:

If you end up getting BBMap then using BBMap as a splice aware aligner is also a great option instead of TopHat.
GenoMax is offline   Reply With Quote
Old 01-14-2016, 02:55 AM   #3
Location: Spain

Join Date: Oct 2015
Posts: 10

Originally Posted by GenoMax View Post
If you are only running bowtie2 to estimate insert size then you could use BBMerge:

If you end up getting BBMap then using BBMap as a splice aware aligner is also a great option instead of TopHat.
Thanks I'll give a try to BBMerge to calculate insert size, as I'm not sure that using Bowtie2 to calculate this is a good option.

runnerBio88 is offline   Reply With Quote
Old 01-14-2016, 04:09 AM   #4
Devon Ryan
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480

SAM files don't report the mate inner distance, they report the (apparent) fragment size, which is 165 rather than 9. The inner mate distance is just that minus the sum of the read lengths.
dpryan is offline   Reply With Quote

bowtie2, rnaseq, sam

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 03:44 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO