SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
velvet- stats.txt file vani s kulkarni Bioinformatics 4 12-10-2019 08:42 PM
ALLPATHS: does it work? francesco.vezzi Bioinformatics 35 06-01-2014 05:21 AM
Using bam file as the input for velvet elisadouzi Bioinformatics 1 04-13-2012 04:27 PM
[Velvet,assembly] core dumped occured by runnning velvet matador3000 De novo discovery 0 12-17-2011 07:31 AM
Failure of transforming Velvet .afg file into GDE .contig file ZhigangLi Bioinformatics 0 11-25-2010 05:03 PM

Reply
 
Thread Tools
Old 08-08-2012, 07:32 AM   #1
Wizard50
Junior Member
 
Location: ScienceWorld

Join Date: Aug 2012
Posts: 3
Default Need explication about how work the LastGraph file of Velvet

Hello everyone,

I'm student in computer science and I work on a bioinformatics project which has to analyze a LastGraph file of Velvet. So I'm not an expert in bioinformatics but I think I know at least the basics to achieve my project. I read the paper about Velvet and the manual.

The problem is now, I have an example of LastGraph file in front of me and I don't understand how it works in relation to the description given in the paper.

In the manual, they say about the nodes :
"This means that the two sequences given above are not reverse-complements of each other but reverse-complements shifted by k nucleotides".
I am not sure to understand that ...

For example, I have in my LastGraph file this node :

Code:
NODE	1	161	602	602	0	0	0	0	0	0
ACTAACAGTCCTGTTATATCCCTAGGTCTTTCTAACGCGGGGGCGGCCGTAATTTTGCAATTTACTCCCATTGCTGAGGCTAAAATCAGGGAAATGGTGGTTTTTCCCAGGCCAGGGGGCCCATATAAGAGGAGATGATCCATCGGTTCATTACGGGTTTT
CCCTGATTTTAGCCTCAGCAATGGGAGTAAATTGCAAAATTACGGCCGCCCCCGCGTTAGAAAGACCTAGGGATATAACAGGACTGTTAGTTAGCTTAAAACCAGGAGATATTCTATTTATTGATGAAATTCATCGGCTTAACCGTTTAACCGAAGAATTG
I see that the first 91 nucleotides of each sequence here are the reverse-complements of the first 91 nucleotides of the other sequence.
I thought during a while that each sequence given in this node corresponds to some overlapping words of length k, but this would mean that that last k-1 nucleotides of this node overlap exactly on the first k-1 nucleotides of the node connected to this one. Or in my file, this is never the case.

I think there is something important that I did not understand and I would be very grateful if you could explain it to me.

I have another question : in the Velvet manual, they say at the end that there is a tool named "layout" that allow to transform the LastGraph file into DOT file but it is not inside the last version of Velvet ... did they delete it ?

Thank you for you help !

Best
Wizard50 is offline   Reply With Quote
Old 08-08-2012, 01:51 PM   #2
cliffbeall
Senior Member
 
Location: Ohio

Join Date: Jan 2010
Posts: 144
Default Try the mailing list?

It's at http://listserver.ebi.ac.uk/mailman/...o/velvet-users
cliffbeall is offline   Reply With Quote
Old 08-08-2012, 09:39 PM   #3
Tong.W
Member
 
Location: China

Join Date: Jul 2012
Posts: 14
Default

I have never seen the source code ,but i have used it many times. Assembly is a very complete work. There are lots of aspects you need to take into account. I know that in SOAPdenovo when construct scaffold last step ,the contig will be cut K bp length which K means the setting kmer length.
Tong.W is offline   Reply With Quote
Old 09-13-2012, 08:08 PM   #4
F-flow
Junior Member
 
Location: Australia

Join Date: Apr 2010
Posts: 3
Default

Wizard50 > The layout script was removed in version V 1.0.19: https://github.com/dzerbino/velvet/b...ster/ChangeLog. I do not know why. You can still get Velvet (and layout) version 1.0.18 from http://www.ebi.ac.uk/~zerbino/velvet/velvet_1.0.18.tgz .
F-flow is offline   Reply With Quote
Old 09-13-2012, 08:13 PM   #5
F-flow
Junior Member
 
Location: Australia

Join Date: Apr 2010
Posts: 3
Default

This is the commit when layout was removed: https://github.com/dzerbino/velvet/c...aaa4204653a292
F-flow is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:59 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO