SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Viral genome assembly from RNA-seq data mcastro RNA Sequencing 2 11-15-2015 05:21 AM
how to do test on RNA-seq data like this shuixiangyuer RNA Sequencing 1 01-17-2013 09:27 AM
Cufflinks error message on test data Sherry Bioinformatics 12 07-23-2012 05:02 AM
Tophat Fusion error with mRNAseq data M&M Bioinformatics 7 05-26-2012 02:06 AM

Reply
 
Thread Tools
Old 01-02-2014, 02:37 PM   #1
akhattri
Member
 
Location: Chicago ZIP Code 60637

Join Date: Mar 2011
Posts: 8
Default Viral Fusion Seq Error with the test data

hi There,
I am getting this error while running VFS (http://sourceforge.net/projects/viralfusionseq/) (VERSION: Revision 1250) on CentOS 5 release 5.10 (Final) system. After this error SSAKE also fails. Please let me know how this can be fixed. The portions of error output are below. Thanks for the help.

Code:
Command
perl 2.run.example.dataset.pl

The file "2.run.example.dataset.pl" has a the following command:
perl viral.fusion.pl --config vfs.conf --insertSIZE 350 HKCI5a CL7R_1_VFS.fq CL7R_2_VFS.fq

Both the fq files are included in vfs and I edited vfs.conf file to include the path of 3rd party software.


Error 1
Hashing CL7R_1_VFS.dynamic.min35.fq.gz
Hashing CL7R_2_VFS.dynamic.min35.fq.gz
Use of uninitialized value in concatenation (.) or string at
	/data3/users/arun/Apps/vfs/include/RPmethod.pm line 268 (#1)
    (W uninitialized) An undefined value was used as if it were already
    defined.  It was interpreted as a "" or a 0, but maybe it was a mistake.
    To suppress this warning assign a defined value to your variables.
    
    To help you figure out what was undefined, perl tells you what operation
    you used the undefined value in.  Note, however, that perl optimizes your
    program and the operation displayed in the warning may not necessarily
    appear literally in your program.  For example, "that $foo" is
    usually optimized into "that " . $foo, and the warning will refer to
    the concatenation (.) operator, even though there is no . in your
    program.
    
Hashing vfs_dev.HKCI5a.4h_map.fq
Entering Essential::tx_targeted_assembly.
Skipped Insert Size estimation. Supplied insert size: 350
Essential::ssake_reads_prep
Assuming fasta file
Hashing vfs_dev.HKCI5a.RPm.out_2.fa
Processing vfs_dev.HKCI5a.RPm.out_1.fa and vfs_dev.HKCI5a.RPm.out_2.fa
Use of uninitialized value in pattern match (m//) at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 2 (#1)
Use of uninitialized value in concatenation (.) or string at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 2 (#1)
Use of uninitialized value in pattern match (m//) at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 4 (#1)
Use of uninitialized value in concatenation (.) or string at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 4 (#1)
 

 --------------continued to even no of lines (6,8,10,12,14...36)--------------

	/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 38 (#1)
Use of uninitialized value in concatenation (.) or string at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 38 (#1)

Code:
Error 2: SSAKE

Running: /data3/users/arun/Apps/ssake_v3-8/SSAKE [v3.8]
-f vfs_dev.HKCI5a.RPm.plus.vicinity.CS_FnR.ssake.in
-s vfs_dev.HKCI5a.CSm.out.fullread.fa
	-i 0
-h 0
-w 1
-m 20
-o 3
-r 0.9
-t 0
-z 100
-p 1
-e 0.75
-k 4
-a 0.5
-x 20
Unpaired reads (optional) -g no-g
Scaffolds: vfs_dev.HKCI5a.targeted.assembly.sensitive.scaffolds
Merged contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.mergedcontigs
Pairing issues: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_issues
Pairing distance distribution: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_distribution.csv

Contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.contigs
Singlets: vfs_dev.HKCI5a.targeted.assembly.sensitive.singlets

Excluded reads: vfs_dev.HKCI5a.targeted.assembly.sensitive.short
Log: vfs_dev.HKCI5a.targeted.assembly.sensitive.log

=>Reading sequences initiated Thu Jan  2 14:45:44 CST 2014
Sequence reads loaded:
616Input error at line #618: The sequence "0:" is not in the right format for paired-end reads  -- Fatal
Make sure your input is in the form (input sequences can be of variable lengths):

>test
GCTACGACTATGACATACAGT:GTAGATTGATCGCATGCACGCT

Where : separates paired reads.  Spaces, <<.>> or any characters other than A,C,G or T in your input file might have caused this error, including reads with Ns.
mv: cannot stat `vfs_dev.HKCI5a_temp/*.targeted.*.contigs': No such file or directory
Number of log files deleted:  0

Last edited by akhattri; 01-06-2014 at 01:59 PM.
akhattri is offline   Reply With Quote
Old 01-03-2014, 10:08 AM   #2
dietmar13
Senior Member
 
Location: Vienna

Join Date: Mar 2010
Posts: 107
Default I got also an error, cap3 crashed...

hello,

the run finished, but cap3 crahed twice...
the CSm and .contigs-files are empty.

what could be wrong with cap3?

OS: Scientific Linux 6.3 (=RHEL 6.3), bwa 0.7.5a (problem?)



Code:
Executing:  /home/ws/SW_install/CAP3/CAP3/cap3 vfs_dev.HKCI5a.CSm.out.MS.fa.sim -x cap3 >vfs_dev.HKCI5a.CSm.out.MS.fa.sim.cap3.log 2>>HKCI5a/cap3.log
sh: line 1:  9066 Segmentation fault      (core dumped) /home/ws/SW_install/CAP3/CAP3/cap3 vfs_dev.HKCI5a.CSm.out.MS.fa.sim -x cap3 > vfs_dev.HKCI5a.CSm.out.MS.fa.sim.cap3.log 2>> HKCI5a/cap3.log
Entering Essential::create_simplified_readsID_fa.
Entering Essential::cap3_run.
Executing:  /home/ws/SW_install/CAP3/CAP3/cap3 vfs_dev.HKCI5a.CSm.out.CS.fa.sim -x cap3 >vfs_dev.HKCI5a.CSm.out.CS.fa.sim.cap3.log 2>>HKCI5a/cap3.log
sh: line 1:  9068 Segmentation fault      (core dumped) /home/ws/SW_install/CAP3/CAP3/cap3 vfs_dev.HKCI5a.CSm.out.CS.fa.sim -x cap3 > vfs_dev.HKCI5a.CSm.out.CS.fa.sim.cap3.log 2>> HKCI5a/cap3.log
dietmar13 is offline   Reply With Quote
Old 01-05-2014, 10:44 PM   #3
marcowanger
Senior Member
 
Location: Hong Kong

Join Date: Dec 2008
Posts: 350
Default

Hi akhattri and dietmar13, I suppose there was some problem in processing the gzipped fastq files (that subsequently lead to the problem you see), I should have fixed the problem.

Would you mind downloading the latest version again?

https://sourceforge.net/projects/vir...ar.gz/download

Thanks.

Marco
__________________
Marco
marcowanger is offline   Reply With Quote
Old 01-06-2014, 02:20 AM   #4
dietmar13
Senior Member
 
Location: Vienna

Join Date: Mar 2010
Posts: 107
Default problem not solved

dear marco,

thank you, but the problem is the same.

what could be wrong with cap3?
file "vfs_dev.HKCI5a_gz.CSm.out.CS.fa.sim" is empty!

cap3 works on their example data set xyz...

OS: Scientific Linux 6.3 (=RHEL 6.3), bwa 0.7.5a (problem?)

Code:
Entering Essential::cap3_run.
Executing:  /home/ws/SW_install/CAP3/CAP3/cap3 vfs_dev.HKCI5a_gz.CSm.out.MS.fa.sim -x cap3 >vfs_dev.HKCI5a_gz.CSm.out.MS.fa.sim.cap3.log 2>>vfs_dev.HKCI5a_gz.log/cap3.log
sh: line 1:  8445 Segmentation fault      (core dumped) /home/ws/SW_install/CAP3/CAP3/cap3 vfs_dev.HKCI5a_gz.CSm.out.MS.fa.sim -x cap3 > vfs_dev.HKCI5a_gz.CSm.out.MS.fa.sim.cap3.log 2>> vfs_dev.HKCI5a_gz.log/cap3.log
Entering Essential::create_simplified_readsID_fa.
Entering Essential::cap3_run.
Executing:  /home/ws/SW_install/CAP3/CAP3/cap3 vfs_dev.HKCI5a_gz.CSm.out.CS.fa.sim -x cap3 >vfs_dev.HKCI5a_gz.CSm.out.CS.fa.sim.cap3.log 2>>vfs_dev.HKCI5a_gz.log/cap3.log
sh: line 1:  8447 Segmentation fault      (core dumped) /home/ws/SW_install/CAP3/CAP3/cap3 vfs_dev.HKCI5a_gz.CSm.out.CS.fa.sim -x cap3 > vfs_dev.HKCI5a_gz.CSm.out.CS.fa.sim.cap3.log 2>> vfs_dev.HKCI5a_gz.log/cap3.log
executing RPmethod::exec_RPmethod.

Last edited by dietmar13; 01-06-2014 at 02:24 AM.
dietmar13 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:36 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO