Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Bfast output and "Empty Sequence Dictionary" in .sam output

    Hi there,
    I've recently been struggling with the .sam output file from BFAST postprocess. My goal is to get this output into a .ace format. Anthony Fejes recently tweaked the ConvertToAce utility within the Vancouver Short Read Analysis Package to accept .sam input files. However, when the utility runs I get an output like this:

    Code:
    Line 950
    Line: SRR026786.11209822        0       2010_05_14_New_Consensus_237-1  1130   255      23M4I9M *       0       0       TATCCACTGCACTCCACTCCACTGCCGCCGCTTCGT   IAIII;IFII+II>I)DAEI&>0+43$20*%2)*#"     PG:Z:bfast      AS:i:275        NM:i:9 NH:i:1   IH:i:1  HI:i:1  MD:Z:A7C14^GCCG1TA4A1   XA:i:3
    Ignoring SAM validation error due to lenient parsing:
    Error parsing text SAM file. Empty sequence dictionary.; File SRR026786_postprocess_nounmapped.sam;
    When I used the ValidateSamFile utility from Picard to check my .sam file, I get an error output saying that all of the lines have an empty sequence dictionary.

    The only processing that I've done to the .sam file between BFAST postprocess and the ConvertToAce utility is to remove unmapped reads using samtools view with the following options:

    Code:
    samtools view SRR026786_postprocess.sam -S -F 4 -o SRR026786_postprocess_nounmapped.sam
    ...Which makes me wonder why the Empty Sequence Dictionary error would occur unless there was some issue upstream in the work flow.

    Has anyone else had any issues with Empty Sequence Dictionary in BFAST postprocess .sam output files? Can anyone think of a work around? I know that Picard has the CreateSequenceDictionary utility, but I'm not sure how I could use this to add a sequence dictionary to each aligned read in my .sam file.

    Any ideas would be greatly appreciated.
    Aiden

  • #2
    Originally posted by aiden View Post
    Hi there,
    I've recently been struggling with the .sam output file from BFAST postprocess. My goal is to get this output into a .ace format. Anthony Fejes recently tweaked the ConvertToAce utility within the Vancouver Short Read Analysis Package to accept .sam input files. However, when the utility runs I get an output like this:

    Code:
    Line 950
    Line: SRR026786.11209822        0       2010_05_14_New_Consensus_237-1  1130   255      23M4I9M *       0       0       TATCCACTGCACTCCACTCCACTGCCGCCGCTTCGT   IAIII;IFII+II>I)DAEI&>0+43$20*%2)*#"     PG:Z:bfast      AS:i:275        NM:i:9 NH:i:1   IH:i:1  HI:i:1  MD:Z:A7C14^GCCG1TA4A1   XA:i:3
    Ignoring SAM validation error due to lenient parsing:
    Error parsing text SAM file. Empty sequence dictionary.; File SRR026786_postprocess_nounmapped.sam;
    When I used the ValidateSamFile utility from Picard to check my .sam file, I get an error output saying that all of the lines have an empty sequence dictionary.

    The only processing that I've done to the .sam file between BFAST postprocess and the ConvertToAce utility is to remove unmapped reads using samtools view with the following options:

    Code:
    samtools view SRR026786_postprocess.sam -S -F 4 -o SRR026786_postprocess_nounmapped.sam
    ...Which makes me wonder why the Empty Sequence Dictionary error would occur unless there was some issue upstream in the work flow.

    Has anyone else had any issues with Empty Sequence Dictionary in BFAST postprocess .sam output files? Can anyone think of a work around? I know that Picard has the CreateSequenceDictionary utility, but I'm not sure how I could use this to add a sequence dictionary to each aligned read in my .sam file.

    Any ideas would be greatly appreciated.
    Aiden
    Use the "-h" option with samtools view, otherwise the SAM header (with the sequence dictionary) will not be outputted by "samtools view".

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Essential Discoveries and Tools in Epitranscriptomics
      by seqadmin




      The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
      04-22-2024, 07:01 AM
    • seqadmin
      Current Approaches to Protein Sequencing
      by seqadmin


      Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
      04-04-2024, 04:25 PM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, Today, 11:49 AM
    0 responses
    11 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, Yesterday, 08:47 AM
    0 responses
    16 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-11-2024, 12:08 PM
    0 responses
    61 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 10:19 PM
    0 responses
    60 views
    0 likes
    Last Post seqadmin  
    Working...
    X