SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Control-FREEC: a tool for assessing copy number and allelic content using NGS data valeu Literature Watch 76 09-22-2016 01:16 AM
How have you done splice site prediction on NGS data? aquinom85 Bioinformatics 2 09-14-2013 10:32 AM
ORF prediction in assembled NGS metagenomic/metatranscriptomic data someperson Bioinformatics 5 07-03-2013 08:22 AM
Driver mutations from mouse tumor WGS data? JPreston Bioinformatics 2 06-26-2013 02:42 PM
[NGS - analysis of gene expression data] Machine Learning + RNAseq data Chuckytah Bioinformatics 7 03-05-2012 03:16 AM

Reply
 
Thread Tools
Old 08-26-2013, 05:59 AM   #1
mikesh
Member
 
Location: California

Join Date: Jul 2012
Posts: 29
Post [Tool] Oncofuse: prediction of driver gene fusions from NGS data

Dear fellow bioinformaticians,

I would like to announce a new tool dedicated to post-processing of NGS-based fusion prediction data. The main feature of this tool is the ranking of gene fusions based on their probability to be 'driver' rather than 'passenger' events. Top ranked fusions are promising candidates for validation and further functional study.

The input format is rather straightforward: either breakpoint coordinates in fusion partner genes or raw input from TopHat/FusionCatcher software.

Alongside the tool provides some other useful information on fusion gene composition such as the list of retained domains, etc

Please find the tool itself and the documentation at http://www.unav.es/genetica/oncofuse.html

Thanks in advance for your feedback,
Best regards,
Mikhail Shugay
mikesh is offline   Reply With Quote
Old 08-31-2013, 04:22 PM   #2
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

Interesting. I will give it a try.

Can you also make it work with output bam generated from RNA-STAR?

Thanks!
ymc is offline   Reply With Quote
Old 09-01-2013, 02:31 AM   #3
mikesh
Member
 
Location: California

Join Date: Jul 2012
Posts: 29
Default

Quote:
Originally Posted by ymc View Post
Interesting. I will give it a try.

Can you also make it work with output bam generated from RNA-STAR?

Thanks!
Hello!

I'm not very familiar with RNA-STAR, but as far as I understand from the mailing list (https://groups.google.com/forum/#!forum/rna-star) it also provides the Chimeric.out.junction.txt summary file.

It has the following structure
V1 V2 V3 V4 V5 V6 V7 V8 V9 V10 V11 V12 V13 V14
chr1 14617 - chr7 53255970 + -1 0 0 SRR064287.5803258 14618 50M 53255920 50M
chr1 20616 + chrM 11311 + -1 0 0 SRR064439.7269195 20566 50M 11261 50M

V1 is chr gene1 in fusion
V2 location of beginning of overlap on gene1
V3 strand of gene1
V4 is chr gene2 in fusion
V5 location of beginning of overlap on gene2
V6 strand of gene2
V7 junction type: -1=junction is between the mates, 1=GT/AG, 2=CT/AC, 0 - any other motif
V8 repeat length to the left of the junction
V9 repeat length to the right of the junction
V10 read name
V11 location of end of overlap on gene1
V12 cigar of alignment for read on gene 1
V13 location of end of overlap on gene2
V14 cigar of alignment for reads on gene 2

The problem is that this file is not collapsed: each line corresponds to a single read. Basically the algorithm should collapse the output and enumerate the number reads spanning/encompassing the junction for each breakpoint1/breakpoint2 pair. This should be a part of fusion-detection software, however it is not available for RNA-STAR (see https://groups.google.com/forum/#!se...4/vpvj34J0GV8J).
I'll try to write such script in a reasonable time and let you know.
mikesh is offline   Reply With Quote
Old 09-01-2013, 11:11 PM   #4
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

I have a theoretical question. Does epithelial tissue refer to not yet metastasized cancer cells and mesenchymal tissue refer to metastasized cancer cells?
ymc is offline   Reply With Quote
Old 09-01-2013, 11:16 PM   #5
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

Quote:
Originally Posted by mikesh View Post
Hello!

I'm not very familiar with RNA-STAR, but as far as I understand from the mailing list (https://groups.google.com/forum/#!forum/rna-star) it also provides the Chimeric.out.junction.txt summary file.

It has the following structure
V1 V2 V3 V4 V5 V6 V7 V8 V9 V10 V11 V12 V13 V14
chr1 14617 - chr7 53255970 + -1 0 0 SRR064287.5803258 14618 50M 53255920 50M
chr1 20616 + chrM 11311 + -1 0 0 SRR064439.7269195 20566 50M 11261 50M

V1 is chr gene1 in fusion
V2 location of beginning of overlap on gene1
V3 strand of gene1
V4 is chr gene2 in fusion
V5 location of beginning of overlap on gene2
V6 strand of gene2
V7 junction type: -1=junction is between the mates, 1=GT/AG, 2=CT/AC, 0 - any other motif
V8 repeat length to the left of the junction
V9 repeat length to the right of the junction
V10 read name
V11 location of end of overlap on gene1
V12 cigar of alignment for read on gene 1
V13 location of end of overlap on gene2
V14 cigar of alignment for reads on gene 2

The problem is that this file is not collapsed: each line corresponds to a single read. Basically the algorithm should collapse the output and enumerate the number reads spanning/encompassing the junction for each breakpoint1/breakpoint2 pair. This should be a part of fusion-detection software, however it is not available for RNA-STAR (see https://groups.google.com/forum/#!se...4/vpvj34J0GV8J).
I'll try to write such script in a reasonable time and let you know.
Good to hear that you are thinking about working on it. For my dataset, RNA-STAR is 15x faster than tophat2.0.9, so I am using it for my DE analysis now. If it also works for fusion genes, then I can also switch from tophat-fusion to RNA-STAR as well.
ymc is offline   Reply With Quote
Old 09-02-2013, 02:05 AM   #6
mikesh
Member
 
Location: California

Join Date: Jul 2012
Posts: 29
Default

Quote:
Originally Posted by ymc View Post
I have a theoretical question. Does epithelial tissue refer to not yet metastasized cancer cells and mesenchymal tissue refer to metastasized cancer cells?
No, all the tissue types correspond to expression in normal tissue. It is the average of expression of several representative samples (e.g. T-cells, Spleen, Bone-marrow,.. for HEM). We use these as prior information as it is not so ambiguous as expression in cancer tissue, while allowing to explain some trends such as tissue specificity of genes involved in fusion and lack of functional domains in some fusion partner genes that are actually expression drivers.

Quote:
Originally Posted by ymc View Post
Good to hear that you are thinking about working on it. For my dataset, RNA-STAR is 15x faster than tophat2.0.9, so I am using it for my DE analysis now. If it also works for fusion genes, then I can also switch from tophat-fusion to RNA-STAR as well.
Yes I completely understand your problem, recently had a nightmare with metagenome assembly until I discovered SGA which was very computationally efficient. Could you please provide a sample of your Chimeric.out.junction.txt (this will speed up things a lot).

Regards,
Mike
mikesh is offline   Reply With Quote
Old 09-02-2013, 05:50 AM   #7
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

Oh well, I am getting this missing prom.txt problem with my tophat-fusion output

[Mon Sep 02 21:38:55 HKT 2013] 333687 fusions mapped out of 1159847
[Mon Sep 02 21:38:55 HKT 2013] Getting features for FPG parts
[Mon Sep 02 21:38:55 HKT 2013] Loading expression-related data
Exception in thread "main" java.io.FileNotFoundException: /tank/oncofuse/oncofuse_v1.0.3/libs/AVG/prom.txt (No such file or directory)

It seems to me this can be fixed by renaming the directories to upper case. I am running Ubuntu. I presume you didn't test your program under a linux environment which is not case insensitive in directory names as in Windows.
ymc is offline   Reply With Quote
Old 09-02-2013, 05:58 AM   #8
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

I think I understand mesenchymal tissues now. They refer to sarcomas.
ymc is offline   Reply With Quote
Old 09-02-2013, 06:00 AM   #9
mikesh
Member
 
Location: California

Join Date: Jul 2012
Posts: 29
Default

Quote:
Originally Posted by ymc View Post
Oh well, I am getting this missing prom.txt problem with my tophat-fusion output

[Mon Sep 02 21:38:55 HKT 2013] 333687 fusions mapped out of 1159847
[Mon Sep 02 21:38:55 HKT 2013] Getting features for FPG parts
[Mon Sep 02 21:38:55 HKT 2013] Loading expression-related data
Exception in thread "main" java.io.FileNotFoundException: /tank/oncofuse/oncofuse_v1.0.3/libs/AVG/prom.txt (No such file or directory)

It seems to me this can be fixed by renaming the directories to upper case. I am running Ubuntu. I presume you didn't test your program under a linux environment which is not case insensitive in directory names as in Windows.
It was actually a packaging problem - all tissue types are upper-cased in the script (even if they are lowercase in command line or input file) so all directory names should be upper-cased. I'll update the package.
The code itself was tested on Windows, MacOS and Ubuntu.
mikesh is offline   Reply With Quote
Old 09-02-2013, 07:08 AM   #10
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

Oh well, I am getting null pointer exception after 47min run with my tophat-fusion output

[Mon Sep 02 22:54:02 HKT 2013] 572000 FPG parts processed
[Mon Sep 02 22:54:07 HKT 2013] 573000 FPG parts processed
[Mon Sep 02 22:54:13 HKT 2013] 574000 FPG parts processed
[Mon Sep 02 22:54:19 HKT 2013] 575000 FPG parts processed
[Mon Sep 02 22:54:19 HKT 2013] ==Tissue specific
Exception in thread "main" java.lang.NullPointerException
at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native Method)
at sun.reflect.NativeConstructorAccessorImpl.newInstance(NativeConstructorAccessorImpl.java:57)
at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(DelegatingConstructorAccessorImpl.java:45)
at java.lang.reflect.Constructor.newInstance(Constructor.java:526)
at jsr166y.ForkJoinTask.getThrowableException(ForkJoinTask.java:507)
at jsr166y.ForkJoinTask.reportResult(ForkJoinTask.java:567)
at jsr166y.ForkJoinTask.join(ForkJoinTask.java:611)
at jsr166y.ForkJoinPool.invoke(ForkJoinPool.java:1492)
at groovyx.gpars.extra166y.ParallelArrayWithMapping.apply(ParallelArrayWithMapping.java:48)
at groovyx.gpars.extra166y.ParallelArray.apply(ParallelArray.java:329)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:1085)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at org.codehaus.groovy.runtime.callsite.PojoMetaClassSite.call(PojoMetaClassSite.java:44)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:116)
at groovyx.gpars.pa.GParsPoolUtilHelper.eachParallelPA(GParsPoolUtilHelper.groovy:190)
at groovyx.gpars.GParsPoolUtil.eachParallel(GParsPoolUtil.java:385)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.runtime.metaclass.ReflectionMetaMethod.invoke(ReflectionMetaMethod.java:51)
at org.codehaus.groovy.runtime.metaclass.NewInstanceMetaMethod.invoke(NewInstanceMetaMethod.java:54)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:1085)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at org.codehaus.groovy.runtime.callsite.PojoMetaClassSite.call(PojoMetaClassSite.java:44)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCall(CallSiteArray.java:45)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:108)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:116)
at Oncofuse$_run_closure25_closure62.doCall(Oncofuse.groovy:530)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at org.codehaus.groovy.runtime.metaclass.ClosureMetaClass.invokeMethod(ClosureMetaClass.java:272)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at org.codehaus.groovy.runtime.callsite.PogoMetaClassSite.call(PogoMetaClassSite.java:39)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCall(CallSiteArray.java:45)
at org.codehaus.groovy.runtime.callsite.PogoMetaClassSite.call(PogoMetaClassSite.java:54)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:116)
at groovyx.gpars.GParsPool$_withExistingPool_closure1.doCall(GParsPool.groovy:170)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at org.codehaus.groovy.runtime.metaclass.ClosureMetaClass.invokeMethod(ClosureMetaClass.java:272)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at org.codehaus.groovy.runtime.callsite.PogoMetaClassSite.callCurrent(PogoMetaClassSite.java:66)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.callCurrent(AbstractCallSite.java:141)
at groovyx.gpars.GParsPool$_withExistingPool_closure1.doCall(GParsPool.groovy)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at org.codehaus.groovy.runtime.metaclass.ClosureMetaClass.invokeMethod(ClosureMetaClass.java:272)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at groovy.lang.Closure.call(Closure.java:411)
at groovy.lang.Closure.call(Closure.java:405)
at org.codehaus.groovy.runtime.GroovyCategorySupport$ThreadCategoryInfo.use(GroovyCategorySupport.java:109)
at org.codehaus.groovy.runtime.GroovyCategorySupport$ThreadCategoryInfo.access$400(GroovyCategorySupport.java:65)
at org.codehaus.groovy.runtime.GroovyCategorySupport.use(GroovyCategorySupport.java:249)
at org.codehaus.groovy.runtime.DefaultGroovyMethods.use(DefaultGroovyMethods.java:385)
at org.codehaus.groovy.runtime.dgm$594.invoke(Unknown Source)
at org.codehaus.groovy.runtime.callsite.StaticMetaMethodSite$StaticMetaMethodSiteNoUnwrapNoCoerce.invoke(StaticMetaMethodSite.java:148)
at org.codehaus.groovy.runtime.callsite.StaticMetaMethodSite.callStatic(StaticMetaMethodSite.java:99)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.callStatic(AbstractCallSite.java:169)
at groovyx.gpars.GParsPool.withExistingPool(GParsPool.groovy:169)
at groovyx.gpars.GParsPool$withExistingPool.callStatic(Unknown Source)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCallStatic(CallSiteArray.java:53)
at groovyx.gpars.GParsPool$withExistingPool.callStatic(Unknown Source)
at groovyx.gpars.GParsPool.withPool(GParsPool.groovy:141)
at groovyx.gpars.GParsPool$withPool$0.callStatic(Unknown Source)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCallStatic(CallSiteArray.java:53)
at groovyx.gpars.GParsPool$withPool$0.callStatic(Unknown Source)
at groovyx.gpars.GParsPool.withPool(GParsPool.groovy:117)
at groovyx.gpars.GParsPool$withPool.call(Unknown Source)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCall(CallSiteArray.java:45)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:108)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:120)
at Oncofuse$_run_closure25.doCall(Oncofuse.groovy:529)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at org.codehaus.groovy.runtime.metaclass.ClosureMetaClass.invokeMethod(ClosureMetaClass.java:272)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at groovy.lang.Closure.call(Closure.java:411)
at groovy.lang.Closure.call(Closure.java:427)
at org.codehaus.groovy.runtime.DefaultGroovyMethods.callClosureForMapEntry(DefaultGroovyMethods.java:3876)
at org.codehaus.groovy.runtime.DefaultGroovyMethods.each(DefaultGroovyMethods.java:1355)
at org.codehaus.groovy.runtime.dgm$149.invoke(Unknown Source)
at org.codehaus.groovy.runtime.callsite.PojoMetaMethodSite$PojoMetaMethodSiteNoUnwrapNoCoerce.invoke(PojoMetaMethodSite.java:271)
at org.codehaus.groovy.runtime.callsite.PojoMetaMethodSite.call(PojoMetaMethodSite.java:53)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCall(CallSiteArray.java:45)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:108)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:116)
at Oncofuse.run(Oncofuse.groovy:527)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:1085)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at org.codehaus.groovy.runtime.InvokerHelper.invokePogoMethod(InvokerHelper.java:848)
at org.codehaus.groovy.runtime.InvokerHelper.invokeMethod(InvokerHelper.java:831)
at org.codehaus.groovy.runtime.InvokerHelper.runScript(InvokerHelper.java:407)
at org.codehaus.groovy.runtime.InvokerHelper$runScript.call(Unknown Source)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCall(CallSiteArray.java:45)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:108)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:120)
at Oncofuse.main(Oncofuse.groovy)
Caused by: java.lang.NullPointerException
ymc is offline   Reply With Quote
Old 09-02-2013, 07:17 AM   #11
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

I head -n 100000 my tophat-fusion output and still getting this error. Let me repeat this process and check out which line is causing the problem.

[Mon Sep 02 23:15:11 HKT 2013] 26000 FPG parts processed
[Mon Sep 02 23:15:17 HKT 2013] 27000 FPG parts processed
[Mon Sep 02 23:15:18 HKT 2013] ==Tissue specific
Exception in thread "main" java.lang.NullPointerException
at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native Method)
at sun.reflect.NativeConstructorAccessorImpl.newInstance(NativeConstructorAccessorImpl.java:57)
at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(DelegatingConstructorAccessorImpl.java:45)
at java.lang.reflect.Constructor.newInstance(Constructor.java:526)
at jsr166y.ForkJoinTask.getThrowableException(ForkJoinTask.java:507)
at jsr166y.ForkJoinTask.reportResult(ForkJoinTask.java:567)
at jsr166y.ForkJoinTask.join(ForkJoinTask.java:611)
at jsr166y.ForkJoinPool.invoke(ForkJoinPool.java:1492)
at groovyx.gpars.extra166y.ParallelArrayWithMapping.apply(ParallelArrayWithMapping.java:48)
at groovyx.gpars.extra166y.ParallelArray.apply(ParallelArray.java:329)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:1085)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at org.codehaus.groovy.runtime.callsite.PojoMetaClassSite.call(PojoMetaClassSite.java:44)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:116)
at groovyx.gpars.pa.GParsPoolUtilHelper.eachParallelPA(GParsPoolUtilHelper.groovy:190)
at groovyx.gpars.GParsPoolUtil.eachParallel(GParsPoolUtil.java:385)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.runtime.metaclass.ReflectionMetaMethod.invoke(ReflectionMetaMethod.java:51)
at org.codehaus.groovy.runtime.metaclass.NewInstanceMetaMethod.invoke(NewInstanceMetaMethod.java:54)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:1085)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at org.codehaus.groovy.runtime.callsite.PojoMetaClassSite.call(PojoMetaClassSite.java:44)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCall(CallSiteArray.java:45)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:108)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:116)
at Oncofuse$_run_closure25_closure62.doCall(Oncofuse.groovy:530)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at org.codehaus.groovy.runtime.metaclass.ClosureMetaClass.invokeMethod(ClosureMetaClass.java:272)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at org.codehaus.groovy.runtime.callsite.PogoMetaClassSite.call(PogoMetaClassSite.java:39)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCall(CallSiteArray.java:45)
at org.codehaus.groovy.runtime.callsite.PogoMetaClassSite.call(PogoMetaClassSite.java:54)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:116)
at groovyx.gpars.GParsPool$_withExistingPool_closure1.doCall(GParsPool.groovy:170)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at org.codehaus.groovy.runtime.metaclass.ClosureMetaClass.invokeMethod(ClosureMetaClass.java:272)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at org.codehaus.groovy.runtime.callsite.PogoMetaClassSite.callCurrent(PogoMetaClassSite.java:66)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.callCurrent(AbstractCallSite.java:141)
at groovyx.gpars.GParsPool$_withExistingPool_closure1.doCall(GParsPool.groovy)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at org.codehaus.groovy.runtime.metaclass.ClosureMetaClass.invokeMethod(ClosureMetaClass.java:272)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at groovy.lang.Closure.call(Closure.java:411)
at groovy.lang.Closure.call(Closure.java:405)
at org.codehaus.groovy.runtime.GroovyCategorySupport$ThreadCategoryInfo.use(GroovyCategorySupport.java:109)
at org.codehaus.groovy.runtime.GroovyCategorySupport$ThreadCategoryInfo.access$400(GroovyCategorySupport.java:65)
at org.codehaus.groovy.runtime.GroovyCategorySupport.use(GroovyCategorySupport.java:249)
at org.codehaus.groovy.runtime.DefaultGroovyMethods.use(DefaultGroovyMethods.java:385)
at org.codehaus.groovy.runtime.dgm$594.invoke(Unknown Source)
at org.codehaus.groovy.runtime.callsite.StaticMetaMethodSite$StaticMetaMethodSiteNoUnwrapNoCoerce.invoke(StaticMetaMethodSite.java:148)
at org.codehaus.groovy.runtime.callsite.StaticMetaMethodSite.callStatic(StaticMetaMethodSite.java:99)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.callStatic(AbstractCallSite.java:169)
at groovyx.gpars.GParsPool.withExistingPool(GParsPool.groovy:169)
at groovyx.gpars.GParsPool$withExistingPool.callStatic(Unknown Source)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCallStatic(CallSiteArray.java:53)
at groovyx.gpars.GParsPool$withExistingPool.callStatic(Unknown Source)
at groovyx.gpars.GParsPool.withPool(GParsPool.groovy:141)
at groovyx.gpars.GParsPool$withPool$0.callStatic(Unknown Source)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCallStatic(CallSiteArray.java:53)
at groovyx.gpars.GParsPool$withPool$0.callStatic(Unknown Source)
at groovyx.gpars.GParsPool.withPool(GParsPool.groovy:117)
at groovyx.gpars.GParsPool$withPool.call(Unknown Source)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCall(CallSiteArray.java:45)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:108)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:120)
at Oncofuse$_run_closure25.doCall(Oncofuse.groovy:529)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at org.codehaus.groovy.runtime.metaclass.ClosureMetaClass.invokeMethod(ClosureMetaClass.java:272)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at groovy.lang.Closure.call(Closure.java:411)
at groovy.lang.Closure.call(Closure.java:427)
at org.codehaus.groovy.runtime.DefaultGroovyMethods.callClosureForMapEntry(DefaultGroovyMethods.java:3876)
at org.codehaus.groovy.runtime.DefaultGroovyMethods.each(DefaultGroovyMethods.java:1355)
at org.codehaus.groovy.runtime.dgm$149.invoke(Unknown Source)
at org.codehaus.groovy.runtime.callsite.PojoMetaMethodSite$PojoMetaMethodSiteNoUnwrapNoCoerce.invoke(PojoMetaMethodSite.java:271)
at org.codehaus.groovy.runtime.callsite.PojoMetaMethodSite.call(PojoMetaMethodSite.java:53)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCall(CallSiteArray.java:45)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:108)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:116)
at Oncofuse.run(Oncofuse.groovy:527)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:1085)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at org.codehaus.groovy.runtime.InvokerHelper.invokePogoMethod(InvokerHelper.java:848)
at org.codehaus.groovy.runtime.InvokerHelper.invokeMethod(InvokerHelper.java:831)
at org.codehaus.groovy.runtime.InvokerHelper.runScript(InvokerHelper.java:407)
at org.codehaus.groovy.runtime.InvokerHelper$runScript.call(Unknown Source)
at org.codehaus.groovy.runtime.callsite.CallSiteArray.defaultCall(CallSiteArray.java:45)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:108)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:120)
at Oncofuse.main(Oncofuse.groovy)
Caused by: java.lang.NullPointerException
at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native Method)
at sun.reflect.NativeConstructorAccessorImpl.newInstance(NativeConstructorAccessorImpl.java:57)
at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(DelegatingConstructorAccessorImpl.java:45)
at java.lang.reflect.Constructor.newInstance(Constructor.java:526)
at jsr166y.ForkJoinTask.getThrowableException(ForkJoinTask.java:507)
at jsr166y.ForkJoinTask.reportResult(ForkJoinTask.java:567)
at jsr166y.ForkJoinTask.join(ForkJoinTask.java:611)
at groovyx.gpars.extra166y.PAS$FJBase.internalCompute(PAS.java:120)
at groovyx.gpars.extra166y.PAS$FJBase.compute(PAS.java:106)
at jsr166y.RecursiveAction.exec(RecursiveAction.java:148)
at jsr166y.ForkJoinTask.doExec(ForkJoinTask.java:305)
at jsr166y.ForkJoinWorkerThread.execTask(ForkJoinWorkerThread.java:575)
at jsr166y.ForkJoinPool.scan(ForkJoinPool.java:755)
at jsr166y.ForkJoinPool.work(ForkJoinPool.java:617)
at jsr166y.ForkJoinWorkerThread.run(ForkJoinWorkerThread.java:369)
Caused by: java.lang.NullPointerException
at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native Method)
at sun.reflect.NativeConstructorAccessorImpl.newInstance(NativeConstructorAccessorImpl.java:57)
at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(DelegatingConstructorAccessorImpl.java:45)
at java.lang.reflect.Constructor.newInstance(Constructor.java:526)
at jsr166y.ForkJoinTask.getThrowableException(ForkJoinTask.java:507)
at jsr166y.ForkJoinTask.reportResult(ForkJoinTask.java:567)
at jsr166y.ForkJoinTask.join(ForkJoinTask.java:611)
at groovyx.gpars.extra166y.PAS$FJBase.internalCompute(PAS.java:120)
at groovyx.gpars.extra166y.PAS$FJBase.compute(PAS.java:106)
at jsr166y.RecursiveAction.exec(RecursiveAction.java:148)
at jsr166y.ForkJoinTask.doExec(ForkJoinTask.java:305)
at jsr166y.ForkJoinWorkerThread.execTask(ForkJoinWorkerThread.java:575)
at jsr166y.ForkJoinPool.scan(ForkJoinPool.java:733)
... 2 more
Caused by: java.lang.NullPointerException
... 15 more
Caused by: java.lang.NullPointerException
at org.codehaus.groovy.runtime.dgmimpl.NumberNumberPlus$DoubleDouble.call(NumberNumberPlus.java:119)
at Oncofuse$_run_closure25_closure62_closure63_closure65.doCall(Oncofuse.groovy:542)
at sun.reflect.GeneratedMethodAccessor118.invoke(Unknown Source)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at org.codehaus.groovy.runtime.metaclass.ClosureMetaClass.invokeMethod(ClosureMetaClass.java:272)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at groovy.lang.Closure.call(Closure.java:411)
at groovy.lang.Closure.call(Closure.java:427)
at org.codehaus.groovy.runtime.DefaultGroovyMethods.each(DefaultGroovyMethods.java:1326)
at org.codehaus.groovy.runtime.DefaultGroovyMethods.each(DefaultGroovyMethods.java:1298)
at org.codehaus.groovy.runtime.dgm$148.invoke(Unknown Source)
at org.codehaus.groovy.runtime.callsite.PojoMetaMethodSite$PojoMetaMethodSiteNoUnwrapNoCoerce.invoke(PojoMetaMethodSite.java:271)
at org.codehaus.groovy.runtime.callsite.PojoMetaMethodSite.call(PojoMetaMethodSite.java:53)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:116)
at Oncofuse$_run_closure25_closure62_closure63.doCall(Oncofuse.groovy:540)
at sun.reflect.GeneratedMethodAccessor99.invoke(Unknown Source)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at org.codehaus.groovy.runtime.metaclass.ClosureMetaClass.invokeMethod(ClosureMetaClass.java:272)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at org.codehaus.groovy.runtime.callsite.PogoMetaClassSite.call(PogoMetaClassSite.java:39)
at org.codehaus.groovy.runtime.callsite.AbstractCallSite.call(AbstractCallSite.java:116)
at groovyx.gpars.pa.GParsPoolUtilHelper$_eachParallelPA_closure8.doCall(GParsPoolUtilHelper.groovy:190)
at sun.reflect.GeneratedMethodAccessor54.invoke(Unknown Source)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:606)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:90)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:233)
at org.codehaus.groovy.runtime.metaclass.ClosureMetaClass.invokeMethod(ClosureMetaClass.java:272)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:909)
at groovy.lang.Closure.call(Closure.java:411)
at org.codehaus.groovy.runtime.ConvertedClosure.invokeCustom(ConvertedClosure.java:51)
at org.codehaus.groovy.runtime.ConversionHandler.invoke(ConversionHandler.java:82)
at com.sun.proxy.$Proxy6.op(Unknown Source)
at groovyx.gpars.extra166y.AbstractParallelAnyArray$OUPap.leafApply(AbstractParallelAnyArray.java:639)
at groovyx.gpars.extra166y.PAS$FJOApply.atLeaf(PAS.java:147)
... 8 more
ymc is offline   Reply With Quote
Old 09-02-2013, 02:26 PM   #12
mikesh
Member
 
Location: California

Join Date: Jul 2012
Posts: 29
Default

One moment I've tried to debug these and these turned to be several protein interaction partners that don't have associated expression data (not present in Affy array). Check out the package at https://s3-eu-west-1.amazonaws.com/o...use-v1.0.3.zip

The important thing is however, that you're getting around 300,000 gene fusions for your sample (which is an astronomical number). Have you performed a filtering step based on number of spanning/encompassing reads? This should remove lots of false positives. Remember that the tool does functional analysis, but it has NO prior data on the fact that fusion has happened in the sample of interest (there could be many other physiological contraints on fusion formation).

PS If the problem persists, please pm me and I'll give you my mail to send the data that causes the error

Last edited by mikesh; 09-03-2013 at 02:09 AM.
mikesh is offline   Reply With Quote
Old 09-02-2013, 06:05 PM   #13
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

Quote:
Originally Posted by mikesh View Post
One moment I've tried to debug these and these turned to be several protein interaction partners that don't have associated expression data (not present in Affy array). Check out the package at https://s3-eu-west-1.amazonaws.com/o...use-v1.0.3.zip

The important thing is however, that you're getting around 300,000 gene fusions for your sample (which is an astronomical number). Have you performed a filtering step based on number of spanning/encompassing reads? This should remove lots of false positives. Remember that the tool does functional analysis, but it has NO prior data on the fact that fusion has happened in the sample of interest (there could be many other physiological contraints on fusion formation).

PS If the problem persists, please pm me and I'll give you my mail to send the data that causes the error
Can you suggest a way to filter tophat-fusion output? Thanks
ymc is offline   Reply With Quote
Old 09-02-2013, 06:14 PM   #14
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

Looks like the 84094th line of my file is causing the exception.

chr1-chr2 150938563 198629575 rf 1 0 1 240 64 14 36.000000 @ 9 21 35 49 62 @ CAGCTGCCTCCCAGATTAATGCATAAAGCCAAGGAACTACCCCGCTCCCT GCGCTATAGGGTCACTTTAAGCTCTGGGGAAAAAGGAGAAAGTGAGAGGA @ GGTCCCATTGCTGTCACAAAGAAATGAATGTAACTCCTACCCTAATCCCT TTTTTATATAATAAAACTGCCTTAGCATGAGTTGCAACTGTCATCACTAC @ 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 @1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 @

You can download the problematic file here:

http://uploading.com/3979e7eb/fusions-out-gz

You can make it work by removing the last line. The command I ran was:

java -Xmx10G -jar Oncofuse.jar fusions.out tophat EPI onco.out
ymc is offline   Reply With Quote
Old 09-02-2013, 10:29 PM   #15
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

Quote:
Originally Posted by mikesh View Post
One moment I've tried to debug these and these turned to be several protein interaction partners that don't have associated expression data (not present in Affy array). Check out the package at https://s3-eu-west-1.amazonaws.com/o...use-v1.0.3.zip

The important thing is however, that you're getting around 300,000 gene fusions for your sample (which is an astronomical number). Have you performed a filtering step based on number of spanning/encompassing reads? This should remove lots of false positives. Remember that the tool does functional analysis, but it has NO prior data on the fact that fusion has happened in the sample of interest (there could be many other physiological contraints on fusion formation).

PS If the problem persists, please pm me and I'll give you my mail to send the data that causes the error
I tried filtering. For >= 2 spanning reads, there are 80215 fusions. It crashed. Then I tried >=3 spanning reads. There are 26413 fusions. It also crashed. Next, >=4, 16920 fusions. Crashed. Next, >=5, 12334 fusions. Crashed. Next, >=6, 10651 fusions. Crashed. Next, >=7, 9248 fusions. Crashed. Next, >=8, 8352 fusions. Crashed. Next, >=9, 7652 fusions. Crashed. Next, >=10, 7066 fusions. Crashed. Next, >=11, 6532 fusions. Crashed. Next, >=12, 6107 fusions. Crashed. Next, >=13, 5707 fusions. Crashed. Next, >=14, 5389 fusions. Crashed. Next, >=15, 5109 fusions. Crashed. Next, >=16, 4867 fusions. Crashed. Next, >=17, 4641 fusions. Woohoo! Finally finishes!

I think it will be better if you just give a warning and skip the fusions you can't process...
ymc is offline   Reply With Quote
Old 09-03-2013, 01:42 AM   #16
mikesh
Member
 
Location: California

Join Date: Jul 2012
Posts: 29
Default

Quote:
Originally Posted by ymc View Post
I tried filtering. For >= 2 spanning reads, there are 80215 fusions. It crashed. Then I tried >=3 spanning reads. There are 26413 fusions. It also crashed. Next, >=4, 16920 fusions. Crashed. Next, >=5, 12334 fusions. Crashed. Next, >=6, 10651 fusions. Crashed. Next, >=7, 9248 fusions. Crashed. Next, >=8, 8352 fusions. Crashed. Next, >=9, 7652 fusions. Crashed. Next, >=10, 7066 fusions. Crashed. Next, >=11, 6532 fusions. Crashed. Next, >=12, 6107 fusions. Crashed. Next, >=13, 5707 fusions. Crashed. Next, >=14, 5389 fusions. Crashed. Next, >=15, 5109 fusions. Crashed. Next, >=16, 4867 fusions. Crashed. Next, >=17, 4641 fusions. Woohoo! Finally finishes!

I think it will be better if you just give a warning and skip the fusions you can't process...
I've checked the file you've uploaded. It was indeed the problem that I've mentioned (lack of expression data for some protein interaction partners). The package that I've shared (https://s3-eu-west-1.amazonaws.com/o...use-v1.0.3.zip) is working fine with no exceptions, while I was able to reproduce the problem with the old version.

As for filtering of fusions for tophat there are several types of reads: spanning, encompassing and contradictory. The should be set like >1 spanning, >10 encompassing and no contradictory.

Please also provide RNA-Star fusion output so I can implement and debug this input type.

Last edited by mikesh; 09-03-2013 at 02:09 AM.
mikesh is offline   Reply With Quote
Old 09-03-2013, 01:56 AM   #17
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

Quote:
Originally Posted by mikesh View Post
I've checked the file you've uploaded. It was indeed the problem that I've mentioned (lack of expression data for some protein interaction partners). The package that I've shared (https://s3-eu-west-1.amazonaws.com/o...use-v1.0.3.zip) is working fine with no exceptions, while I was able to reproduce the problem with the old version.

As for filtering of fusions for tophat there are several types of reads: spanning, encompassing and contradictory. The should be set like >1 spanning, >10 encompassing and no contradictory.

Please also provide RNA-Star fusion output so I can implement and debug this input type.
I can't download from the URL you provided (even when I replace the ... with ncof). Can you upload it to where your home page is hosted? Thanks!
ymc is offline   Reply With Quote
Old 09-03-2013, 02:01 AM   #18
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

Quote:
Originally Posted by mikesh View Post
I've checked the file you've uploaded. It was indeed the problem that I've mentioned (lack of expression data for some protein interaction partners). The package that I've shared (https://s3-eu-west-1.amazonaws.com/o...use-v1.0.3.zip) is working fine with no exceptions, while I was able to reproduce the problem with the old version.

As for filtering of fusions for tophat there are several types of reads: spanning, encompassing and contradictory. The should be set like >1 spanning, >10 encompassing and no contradictory.

Please also provide RNA-Star fusion output so I can implement and debug this input type.
if I understand correctly, the 5th column is spanning, the 8th column is contradictory. But which column is "encompassing" in fusions.out?
ymc is offline   Reply With Quote
Old 09-03-2013, 02:13 AM   #19
mikesh
Member
 
Location: California

Join Date: Jul 2012
Posts: 29
Default

The new version will be uploaded to home page later in the day.
I've fixed the URL, it is: https://s3-eu-west-1.amazonaws.com/o...use-v1.0.3.zip. There seems to be some trouble with URL pasting here..

As for the tophat output, the columns 5-8 are:
5: span junction, 6: encompassing, 7: one mate spans, other is encompassing, 8: contradictory (supporting unbroken transcript)
mikesh is offline   Reply With Quote
Old 09-03-2013, 03:53 AM   #20
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

By using the

awk '$5>1&&$6>10&&$8==0'

filter, my fusions.out comes down from 1.1mil lines to 2361 lines. The program can finish and I end up with 320 fusions.

There are five fusions in my sample that is confirmed experimentally:

MKL1-NIPA1 MKL1 22q13 NIPA1 15q11.2
HSPG2-TMCO4 HSPG2 1p36.1 TMCO4 1p36.13
NIPAL3-ATAD3B* NIPAL3 1p36.12 ATAD3B 1p36.33
UBFD1-CDH11* UBFD1 16p12 CDH11 16q21
SLC7A6-LRRC36 SLC7A6 16q22.1 LRRC36 16q22.1

But none of them show up in the oncofuse output with the aforementioned filter. They all show up if I use the unfiltered 333,687 fusions original fusions.out as input however. But then how can I find out these five from the 333,687 candidates?

FYI, in contrast, 4 out of 5 show up among the 97 fusions identified by tophat-fusion-post.
ymc is offline   Reply With Quote
Reply

Tags
annotation, driver, fusion, ngs, rna-seq

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:37 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO