SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
bcl2fastq on windows? jdb Illumina/Solexa 5 11-22-2019 07:00 AM
Problem compiling bcl2fastq-1.8.4 emixaM Illumina/Solexa 20 01-05-2015 12:13 PM
bcl2fastq and index length PopGenTech Illumina/Solexa 5 12-19-2014 09:02 AM
bcl2fastq run error wintergreen36 Bioinformatics 14 08-12-2014 05:43 AM
install bcl2fastq-1.8.4 min1204 Bioinformatics 17 07-23-2014 05:37 AM

Reply
 
Thread Tools
Old 03-30-2016, 02:04 PM   #1
DrWorm
Member
 
Location: St. Louis, MO

Join Date: Apr 2013
Posts: 17
Default Comparing Cassava1.8.2 to bcl2fastq

Hello all,

A colleague of mine used Cassava1.8.2 and bcl2fastq to convert the same bcl file to fastq format. I was tasked with proving that the two resulting fastq files (again, the same data from the machine, just different software used to convert to fastq) are identical (i.e., the same sequence, the same quality score for each read). I noticed that some of the quality scores were indeed slightly different.

File 1:
@HWI-Read1_deidentified_name
CCAAGTCTCGCTTACTTTTCATGTCATCCCGTGCCTTCTCCGAGAGGGTTCGCAGGTTCATGTTTTCAAAGATGCTAATGGACGTAGCCCAGGCCAGCGAT
+
0<@<DEEG<DCC<E?CFHHHHHEHHIIHHH@<EEH?FHH11C/<<?@EHICDH=C<FH1FEHHIIH@1111FHIHHEG@1<CG<CH@H1<CCC1<<<?C/1


File 2:
@HWI-Read1_deidentified_name
CCAAGTCTCGCTTACTTTTCATGTCATCCCGTGCCTTCTCCGAGAGGGTTCGCAGGTTCATGTTTTCAAAGATGCTAATGGACGTAGCCCAGGCCAGCGAT
+
0<@<DEEG<DCC<E?CFHHHHHEHHIIHHH@<EEH?FHH11C/<<?@EHICDH=C<FH1FEHHIIH@1111FHIHHEG@1<CG<CH@H1<CCC1<<<?C##


See the difference? Its minor, typically towards the end of the read, typically affecting poor~ish quality bases.

Does anyone have an idea of what might cause this?
DrWorm is offline   Reply With Quote
Old 03-30-2016, 02:45 PM   #2
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,178
Default

Which version of bcl2fastq was used? Casava 1.8.2 is really using bcl2fastq 1.8.2 for demultiplexing. Was the same "standalone" bcl2fastq version used or was it 1.8.4 or the newer 2.x bcl2fastq?
kmcarr is offline   Reply With Quote
Old 03-30-2016, 03:08 PM   #3
DrWorm
Member
 
Location: St. Louis, MO

Join Date: Apr 2013
Posts: 17
Default

I'm told it was bcl2fastq2 2.17.
DrWorm is offline   Reply With Quote
Old 03-30-2016, 03:16 PM   #4
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,138
Default

What kind of sequencer is this data from?

There isn't a way to directly compare bcl2fastq v.2 with CASAVA v.1.8.2 since they can't be used interchangeably (bcl2fastq v.2 can be used for all data but CASAVA can't be used for NextSeq and HiSeq 3K/4K/X data).
GenoMax is offline   Reply With Quote
Old 03-30-2016, 03:55 PM   #5
HESmith
Senior Member
 
Location: Bethesda MD

Join Date: Oct 2009
Posts: 513
Default

Is the difference always a string of quality 2 ('#') at the 3' end of reads? At some point, Illumina used Q2 as an "low quality end-of-read, do not use" indicator.
HESmith is offline   Reply With Quote
Old 03-30-2016, 07:32 PM   #6
DrWorm
Member
 
Location: St. Louis, MO

Join Date: Apr 2013
Posts: 17
Default

Yeah, its mostly (if not all -- I just haven't tested thoroughly) #'s at the 3' end of reads. Seems like it shouldn't make much difference practically???
DrWorm is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:27 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2022, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO