I have two files.
1. An mrna file in which each line looks like -
NR_030382 chr1:100154611-100178513 tattaggttggtgcaaaagtaattgtggtttttgcctgtaaaag
2. An mrna file whose lines are like -
>hsa-miR-576-3p MIMAT0004796
AAGAUGUGGAAAAAUUGGAAUC
Now if i am not wrong, the thing should be like this
> mrna is from 3'utr, so i need to reverse it since mirna is also from 3'
> now considering i am doing 6mer, i need to skip the first character from each sequence from mirna, then search the mrna file for the existence of its compliment
How do I achieve this using bowtie2 ?
Please consider the fact that I am just a regular computer programmer and this is my first time encountering anything related to bioinformatics. I think i'll be needing to do this for 7mer, 8mer and 7mer+a1 also.
P.S - This was of no help, http://seqanswers.com/forums/showthread.php?t=72252
1. An mrna file in which each line looks like -
NR_030382 chr1:100154611-100178513 tattaggttggtgcaaaagtaattgtggtttttgcctgtaaaag
2. An mrna file whose lines are like -
>hsa-miR-576-3p MIMAT0004796
AAGAUGUGGAAAAAUUGGAAUC
Now if i am not wrong, the thing should be like this
> mrna is from 3'utr, so i need to reverse it since mirna is also from 3'
> now considering i am doing 6mer, i need to skip the first character from each sequence from mirna, then search the mrna file for the existence of its compliment
How do I achieve this using bowtie2 ?
Please consider the fact that I am just a regular computer programmer and this is my first time encountering anything related to bioinformatics. I think i'll be needing to do this for 7mer, 8mer and 7mer+a1 also.
P.S - This was of no help, http://seqanswers.com/forums/showthread.php?t=72252