Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • GSNAP error Problem Sequence

    Hi everybody,

    For my RNA-seq analysis, I wanted to use GSNAP to align my reads.
    Building the index ran without any problems, but when I actually start mapping my reads I get first get Signal received: SIGSEGV
    Calling Access_emergency_cleanup, and thereafter "Problem sequence" after which the program stops.

    This is the command I used:
    gsnapl --nthreads 6 -d gsnap_GRCh38_apr2019 -D ${GENOMEDIR} ${READ1}${SUFFIX2} ${READ2}${SUFFIX2} -A sam --output-file ${align_DIR_GSNAP}${READ1:${#SOURCEDIR}:-${#SUFFIX1}-${#PAIR1}}_GSNAP.sam -N 1

    This is what is printed in the terminal:
    [ALIGNING] GSNAP : [APA_The_000_2]
    GSNAP version 2019-06-10 called with args: gsnapl.avx2 --nthreads 6 -d gsnap_GRCh38_apr2019 -D /share/tools/data/genomes/GRCh38_r96_april2019/ /share/analysis/CEFIC/CEFIC_testdata/HeCaToS_APA/Trimmed_reads_trimmomatic/APA_The_000_2_R1.fastq /share/analysis/CEFIC/CEFIC_testdata/HeCaToS_APA/Trimmed_reads_trimmomatic/APA_The_000_2_R2.fastq -A sam --output-file /share/analysis/CEFIC/CEFIC_testdata/HeCaToS_APA/Trimmed_reads_trimmomatic/GSNAP/APA__GSNAP.sam -N 1
    Novel splicing (-N) turned on => assume reads are RNA-Seq
    Checking compiler assumptions for SSE2: 6B8B4567 327B23C6 xor=59F066A1
    Checking compiler assumptions for SSE4.1: -103 -58 max=198 => compiler zero extends
    Checking compiler assumptions for SSE4.2 options: 6B8B4567 __builtin_clz=1 __builtin_ctz=0 _mm_popcnt_u32=17 __builtin_popcount=17
    Finished checking compiler assumptions
    Allocating memory for compressed genome (oligos)...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.genomecomp...done (21,344,119,460 bytes, 13.84 sec)
    Allocating memory for compressed genome (bits)...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.genomebits128...done (21,344,119,488 bytes, 48.13 sec)
    Looking for index files in directory /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019
    Pointers file is gsnap_GRCh38_apr2019.ref153offsets64meta
    Offsets file is gsnap_GRCh38_apr2019.ref153offsets64strm
    Positions files are gsnap_GRCh38_apr2019.ref153positionsh and gsnap_GRCh38_apr2019.ref153positions
    Offsets compression type: bitpack64
    Allocating memory for ref offset pointers, kmer 15, interval 3...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref153offsets64meta...done (134,217,744 bytes, 0.13 sec)
    Allocating memory for ref offsets, kmer 15, interval 3...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref153offsets64strm...done (481,344,896 bytes, 0.36 sec)
    Allocating memory for ref positions, kmer 15, interval 3...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref153positionsh...done (1,029,358,013 bytes, 2.49 sec)
    Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref153positions...done (4,117,432,052 bytes, 9.28 sec)
    Looking for local files in directory /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019
    Table file is gsnap_GRCh38_apr2019.ref081loctable
    Pointers file is gsnap_GRCh38_apr2019.ref081locoffsets64meta
    Offsets file is gsnap_GRCh38_apr2019.ref081locoffsets64strm
    Positions file is gsnap_GRCh38_apr2019.ref081locpositions
    Allocating memory for ref offset pointers, kmer 8, interval 1...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref081locoffsets64meta...done (3,557,355,520 bytes, 3.70 sec)
    Allocating memory for ref offsets, kmer 8, interval 1...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref081locoffsets64strm...done (1,828,434,688 bytes, 4.19 sec)
    Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref081loctable...done (6,947,968 bytes, 0.02 sec)
    Allocating memory for ref positions, kmer 8, interval 1...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref081locpositions...done (6,176,172,160 bytes, 14.58 sec)
    Starting alignment. Writing results to /share/analysis/CEFIC/CEFIC_testdata/HeCaToS_APA/Trimmed_reads_trimmomatic/GSNAP/APA__GSNAP.sam
    Signal received: SIGSEGV
    Calling Access_emergency_cleanup
    Signal received: SIGSEGV
    Calling Access_emergency_cleanup
    Signal received: SIGSEGV
    Calling Access_emergency_cleanup
    Signal received: SIGSEGV
    Calling Access_emergency_cleanup
    Signal received: SIGSEGV
    Calling Access_emergency_cleanup
    Signal received: SIGSEGV
    Calling Access_emergency_cleanup
    Removed existing memory for shmid 347209834
    Removed existing memory for shmid 346980450
    Removed existing memory for shmid 346947667
    Removed existing memory for shmid 347013219
    Removed existing memory for shmid 347177065

    You may want to run 'ipcs -m' to see if any shared memory segments are still in use
    You can remove a shared memory segment manually by doing 'ipcrm -m <shmid>'

    Problem sequence: HWI-ST1172:242:CBVAFACXX:1:1101:6590:2214 (100 bp)
    >HWI-ST1172:242:CBVAFACXX:1:1101:6590:2214
    TTGAACGTTCCATGAGCAGCGAGGTGAACCCAGAACCAGTTCCCCCACCAAAGCTGTGGAAAACCAAGAAGCCCTGGAGACCCGTGCACTGGTCGGCCAG
    AGCCCCGGGCAGTGTTTGTAGACTTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAACTTATCACAGG


    Does anyone know what is exactly the problem here and how to fix this?
    Thanks already,
    Marcha

  • #2
    I realize almost a year passed since this question was asked. I had the same error recently, so after a lot of troubleshooting I found the cause. I had indexed my reference specifying some of the chromosomes as circular and that was causing this particular error, not on every sample though, but very annoying. Once I re-indexed the genome without marking any chromosome as circular the mapping worked without errors.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Recent Advances in Sequencing Analysis Tools
      by seqadmin


      The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
      Yesterday, 07:48 AM
    • seqadmin
      Essential Discoveries and Tools in Epitranscriptomics
      by seqadmin




      The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
      04-22-2024, 07:01 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, Today, 06:57 AM
    0 responses
    9 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, Yesterday, 07:17 AM
    0 responses
    13 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 05-02-2024, 08:06 AM
    0 responses
    19 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-30-2024, 12:17 PM
    0 responses
    23 views
    0 likes
    Last Post seqadmin  
    Working...
    X