SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
SRA to fastq conversion with fastq-dump loses sequences pcantalupo Bioinformatics 13 10-08-2015 05:09 PM
How to keep the raw .fastq.gz files for RNASeq data shirley0818 RNA Sequencing 5 03-25-2014 10:15 AM
Odd results with Sickle FASTQ trimming id0 Bioinformatics 0 04-19-2013 10:07 AM
RNASeq - overrepresent sequences JoaoMoura Bioinformatics 2 03-28-2011 11:58 AM
unambiguous assembly of RNAseq fastq avilella Bioinformatics 0 03-06-2010 07:43 AM

Reply
 
Thread Tools
Old 11-19-2019, 11:31 PM   #1
Kujin Kwon
Junior Member
 
Location: Korea, South

Join Date: Dec 2018
Posts: 9
Default Odd sequences in RNAseq fastq

Hi all,

Recently, I just ran iSeq for pair ended RNA sequencing and it gave me odd fastq results
Some of Read1(i7) sequences have Adapter sequences with poly G at the end.

@FS10000436:35:BPC29621-1807:1:1101:10010:1370 1:N:0:1
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTATGCCGTCTTCTGCTTGAAAAAAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF::FFFFFFFF:FFFFFFFFFFFFFF::FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

However paired Read2(i5) sequences gave me random and poor quality sequences
@FS10000436:35:BPC29621-1807:1:1101:10010:1370 2:N:0:1
GGGGGGGGGAATTTTTTTTTTTTAAAAAATATTTTTTTTTCTTTTTTTTTTTTTTTTTTCCCTTTTTTTTTTTATATTTTTTTTTTTTTTTTTATATTTTT
+
F:,,,,,,,,,,,F,,:,:FFF,,,::FF,,,,FFF,,,,,:,FFF::FF::,F::F,,,,,,,F,FF::::,,,,,,::F:FFFFFFF,F,,,,,,,,,:

I guess this problem came from library length which is shorter than sequencing length. However, I can't understand why Read2 sequence doesn't show matched short sequences (like adapter with G sequences) but random sequences. Is it cluster problems by short sequences?

Thanks in advance.

Last edited by Kujin Kwon; 11-20-2019 at 02:39 AM.
Kujin Kwon is offline   Reply With Quote
Old 11-20-2019, 03:29 PM   #2
cmbetts
Senior Member
 
Location: Bay Area

Join Date: Jun 2012
Posts: 112
Default

I take it these are NextSeq or NovaSeq?

This is an adapter dimer that's read through the p7 sequence (ATCTCGTATGCCGTCTTCTGCTTG) into the FC and started spitting out Gs because no template = no signal = G in 2 color chemistry
cmbetts is offline   Reply With Quote
Old 11-21-2019, 04:31 AM   #3
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,992
Default

OP says these are from iSeq.
GenoMax is offline   Reply With Quote
Old 11-21-2019, 09:36 AM   #4
cmbetts
Senior Member
 
Location: Bay Area

Join Date: Jun 2012
Posts: 112
Default

Whoops. Same conclusion though. Gs are still the dark channel in the iSeq chemistry
cmbetts is offline   Reply With Quote
Old 11-24-2019, 09:09 PM   #5
Kujin Kwon
Junior Member
 
Location: Korea, South

Join Date: Dec 2018
Posts: 9
Default

Thanks for the answer @cmbetts

Quote:
no template = no signal = G in 2 color chemistry
Then, random sequence in read2 is also signal of no template?
Kujin Kwon is offline   Reply With Quote
Reply

Tags
illumina fastq, iseq, rna sequencing

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:46 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO