SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
GMAP gsnap input error Irina Pulyakhina RNA Sequencing 10 10-23-2014 07:10 PM
GSNAP gives Bus Error: 10 unicornich Bioinformatics 1 08-20-2014 08:53 AM
GSNAP error aaron.odell Bioinformatics 3 03-11-2014 10:56 AM
GSNAP error on cygwin afiroz Bioinformatics 0 01-16-2013 09:55 PM
problem with gsnap sam output lindseyjane Bioinformatics 2 11-04-2010 05:27 AM

Reply
 
Thread Tools
Old 07-04-2019, 03:09 AM   #1
Marcha
Junior Member
 
Location: Maastricht, The Netherlands

Join Date: Jul 2019
Posts: 2
Default GSNAP error Problem Sequence

Hi everybody,

For my RNA-seq analysis, I wanted to use GSNAP to align my reads.
Building the index ran without any problems, but when I actually start mapping my reads I get first get Signal received: SIGSEGV
Calling Access_emergency_cleanup, and thereafter "Problem sequence" after which the program stops.

This is the command I used:
gsnapl --nthreads 6 -d gsnap_GRCh38_apr2019 -D ${GENOMEDIR} ${READ1}${SUFFIX2} ${READ2}${SUFFIX2} -A sam --output-file ${align_DIR_GSNAP}${READ1:${#SOURCEDIR}:-${#SUFFIX1}-${#PAIR1}}_GSNAP.sam -N 1

This is what is printed in the terminal:
[ALIGNING] GSNAP : [APA_The_000_2]
GSNAP version 2019-06-10 called with args: gsnapl.avx2 --nthreads 6 -d gsnap_GRCh38_apr2019 -D /share/tools/data/genomes/GRCh38_r96_april2019/ /share/analysis/CEFIC/CEFIC_testdata/HeCaToS_APA/Trimmed_reads_trimmomatic/APA_The_000_2_R1.fastq /share/analysis/CEFIC/CEFIC_testdata/HeCaToS_APA/Trimmed_reads_trimmomatic/APA_The_000_2_R2.fastq -A sam --output-file /share/analysis/CEFIC/CEFIC_testdata/HeCaToS_APA/Trimmed_reads_trimmomatic/GSNAP/APA__GSNAP.sam -N 1
Novel splicing (-N) turned on => assume reads are RNA-Seq
Checking compiler assumptions for SSE2: 6B8B4567 327B23C6 xor=59F066A1
Checking compiler assumptions for SSE4.1: -103 -58 max=198 => compiler zero extends
Checking compiler assumptions for SSE4.2 options: 6B8B4567 __builtin_clz=1 __builtin_ctz=0 _mm_popcnt_u32=17 __builtin_popcount=17
Finished checking compiler assumptions
Allocating memory for compressed genome (oligos)...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.genomecomp...done (21,344,119,460 bytes, 13.84 sec)
Allocating memory for compressed genome (bits)...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.genomebits128...done (21,344,119,488 bytes, 48.13 sec)
Looking for index files in directory /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019
Pointers file is gsnap_GRCh38_apr2019.ref153offsets64meta
Offsets file is gsnap_GRCh38_apr2019.ref153offsets64strm
Positions files are gsnap_GRCh38_apr2019.ref153positionsh and gsnap_GRCh38_apr2019.ref153positions
Offsets compression type: bitpack64
Allocating memory for ref offset pointers, kmer 15, interval 3...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref153offsets64meta...done (134,217,744 bytes, 0.13 sec)
Allocating memory for ref offsets, kmer 15, interval 3...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref153offsets64strm...done (481,344,896 bytes, 0.36 sec)
Allocating memory for ref positions, kmer 15, interval 3...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref153positionsh...done (1,029,358,013 bytes, 2.49 sec)
Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref153positions...done (4,117,432,052 bytes, 9.28 sec)
Looking for local files in directory /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019
Table file is gsnap_GRCh38_apr2019.ref081loctable
Pointers file is gsnap_GRCh38_apr2019.ref081locoffsets64meta
Offsets file is gsnap_GRCh38_apr2019.ref081locoffsets64strm
Positions file is gsnap_GRCh38_apr2019.ref081locpositions
Allocating memory for ref offset pointers, kmer 8, interval 1...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref081locoffsets64meta...done (3,557,355,520 bytes, 3.70 sec)
Allocating memory for ref offsets, kmer 8, interval 1...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref081locoffsets64strm...done (1,828,434,688 bytes, 4.19 sec)
Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref081loctable...done (6,947,968 bytes, 0.02 sec)
Allocating memory for ref positions, kmer 8, interval 1...Attached new memory for /share/tools/data/genomes/GRCh38_r96_april2019//gsnap_GRCh38_apr2019/gsnap_GRCh38_apr2019.ref081locpositions...done (6,176,172,160 bytes, 14.58 sec)
Starting alignment. Writing results to /share/analysis/CEFIC/CEFIC_testdata/HeCaToS_APA/Trimmed_reads_trimmomatic/GSNAP/APA__GSNAP.sam
Signal received: SIGSEGV
Calling Access_emergency_cleanup
Signal received: SIGSEGV
Calling Access_emergency_cleanup
Signal received: SIGSEGV
Calling Access_emergency_cleanup
Signal received: SIGSEGV
Calling Access_emergency_cleanup
Signal received: SIGSEGV
Calling Access_emergency_cleanup
Signal received: SIGSEGV
Calling Access_emergency_cleanup
Removed existing memory for shmid 347209834
Removed existing memory for shmid 346980450
Removed existing memory for shmid 346947667
Removed existing memory for shmid 347013219
Removed existing memory for shmid 347177065

You may want to run 'ipcs -m' to see if any shared memory segments are still in use
You can remove a shared memory segment manually by doing 'ipcrm -m <shmid>'

Problem sequence: HWI-ST1172:242:CBVAFACXX:1:1101:6590:2214 (100 bp)
>HWI-ST1172:242:CBVAFACXX:1:1101:6590:2214
TTGAACGTTCCATGAGCAGCGAGGTGAACCCAGAACCAGTTCCCCCACCAAAGCTGTGGAAAACCAAGAAGCCCTGGAGACCCGTGCACTGGTCGGCCAG
AGCCCCGGGCAGTGTTTGTAGACTTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAACTTATCACAGG


Does anyone know what is exactly the problem here and how to fix this?
Thanks already,
Marcha
Marcha is offline   Reply With Quote
Reply

Tags
gsnap, problem sequence, sigsegv

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:33 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO