SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
different duplication levels in forward reverse libraries Mchicken Bioinformatics 3 09-09-2014 04:55 AM
Paired end reverse orientation? darthsequencer Illumina/Solexa 11 03-15-2013 10:45 AM
MetaSim: why paired end reverse read is much shorter than forward read?? gen_argentino Bioinformatics 0 09-06-2012 06:38 AM
rmdup can not move duplicates in forward and reverse strand for single-end reads ct586 Bioinformatics 4 03-11-2012 05:01 PM
Forward adapter at end of forward paired end read? darthsequencer Illumina/Solexa 1 03-04-2012 01:37 PM

Reply
 
Thread Tools
Old 10-09-2014, 08:24 AM   #1
skmotay
Member
 
Location: MN

Join Date: Oct 2014
Posts: 29
Default For paired end libraries, how do I know which is forward and which is reverse?

For paired end libraries, how do I know which is forward and which is reverse?

I've got the files in galaxy, but I don't know which are forward and which are reverse, just that they're paired.
skmotay is offline   Reply With Quote
Old 10-09-2014, 09:20 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978
Default

File with R1 in the name is the first read and R2 is the second read (other end) from the same set of fragments.
GenoMax is offline   Reply With Quote
Old 10-09-2014, 09:38 AM   #3
skmotay
Member
 
Location: MN

Join Date: Oct 2014
Posts: 29
Default

The file names don't have those. After the genotype, they just say lane_4 of lane_5
skmotay is offline   Reply With Quote
Old 10-09-2014, 09:55 AM   #4
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

Can you post a complete filename, and also the first 8 lines from that file?
Brian Bushnell is offline   Reply With Quote
Old 10-09-2014, 09:57 AM   #5
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978
Default

Have the reads been processed in any way (i.e. collapsed into a single long read, possible if the insert is short and reads overlap)?

If reads ARE really paired, then they can't be in separate lanes (there would be two files per lane).
GenoMax is offline   Reply With Quote
Old 10-09-2014, 10:07 AM   #6
skmotay
Member
 
Location: MN

Join Date: Oct 2014
Posts: 29
Default

File name:

Galaxy3-[WT_2_lane4.fastq].fastq (then the next file is the same, except lane5. each genotype has two files, one lane four and one lane 5)

@GWZHISEQ02:321YMKACXX:5:1101:1297:1992 1:N:0:ATCACG
TTTGGATCGTTCACAAATTGAGAGAGGTTTTCGCGTAGGAAGTACTTGNCC
+
CCCFFFFFHHHFHJJIIJJJJJJJJJJ@GHJIIJJJGIJEIJBFHIJI###
@GWZHISEQ02:321YMKACXX:5:1101:1692:1983 1:N:0:ATCACG
CCCGCCCTTCTTGCCGCGCGGCNGCATCATTCGGTTGGGCACGCCGCNNNN
+
@@@DDADDHFFHHIII@GGIIG#07<FDHIIG@F5AGHFEBE??A@B####
@GWZHISEQ02:321YMKACXX:5:1101:2408:1992 1:N:0:ATCACG
GTACTTGTAGAGCTCGGTGTATGTAATCCTGTCCTCAGCGGTCCAGCTNAA
+
@<<DDEDDHGFHHIDEHCGIIGIDHHJ@HHIGIAFEIGEEGIIIGHIG###
@GWZHISEQ02:321YMKACXX:5:1101:3073:1994 1:N:0:ATCACG
CCGAGTTCTCCTGGTACCAGCAGATCGAGATGGGCTACGACCCCCAGCNGA
+
@@CFFDFFHHHHHJGHIJJIIJJJJJJJJIIJJIGIHIIJJJJJJJJJ###
@GWZHISEQ02:321YMKACXX:5:1101:3748:1991 1:N:0:ATCACG
GTGCGTTCGCTGGAGAATGTGTGCCGCGACCTGATCAACGGTGCAAAGNAC
+
@@@DDDDDAHFDFFHFEFHIIJEGGIEGEHIJGBGIGGIIG?EHHFDF###
@GWZHISEQ02:321YMKACXX:5:1101:3653:1998 1:N:0:ATCACG
CTGACTGGCATGATCCAGTCGACGATGATGGCCATGCCCTACATGGACAAA
+
CCCFFFFFHHHHHJJJJJJJJJJJHJJJJJJJJJJJJJJIJJJJJJJJJJ#
@GWZHISEQ02:321YMKACXX:5:1101:5002:1996 1:N:0:ATCACG
CCTCAGTTCTCCTGGTTCCACCAGATCGAGATGGGCTACGATCCACAANTG
+
???;:=2=A=D<DEBE::+<<F3<33A?1811111)11:6)0000?D####
@GWZHISEQ02:321YMKACXX:5:1101:5470:1986 1:N:0:ATCACG
CTGGATATCAATAATGCTCTCCNTAGGGATATTTCCCGCAAATTTGANNNN
+
CCCFFFFFHHHHHJJJJJJJJJ#3AGIJJJJJJJJJJJJJJJJJJJJ####



When I try to take the two with the same geno# and map them as paired end, I get this:
Left reads:
Input: 22670964
Mapped: 21232534 (93.7% of input)
of these: 1499440 ( 7.1%) have multiple alignments (0 have >20)
Right reads:
Input: 22516885
Mapped: 21088604 (93.7% of input)
of these: 1487965 ( 7.1%) have multiple alignments (0 have >20)
93.7% overall read alignment rate.

Aligned pairs: 19856733
of these: 99084 ( 0.5%) have multiple alignments
and: 18762256 (94.5%) are discordant alignments
4.9% concordant pair alignment rate.

Last edited by skmotay; 10-09-2014 at 10:15 AM.
skmotay is offline   Reply With Quote
Old 10-09-2014, 10:21 AM   #7
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

These reads are not paired.

@GWZHISEQ02:321YMKACXX:5:1101:1297:1992 1:N:0:ATCACG

That 1 indicates it is read 1. So you get a high discordant rate because you are mapping unrelated single-ended reads as if they were paired.
Brian Bushnell is offline   Reply With Quote
Old 10-09-2014, 10:25 AM   #8
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978
Default

If your description is right then they are not paired end reads. Just a sample run in two lanes.

For them to be true paired-end reads, each sample will need to have two files (from the same lane) with the naming convention described here: http://en.wikipedia.org/wiki/FASTQ_f...ce_identifiers
GenoMax is offline   Reply With Quote
Old 10-09-2014, 10:30 AM   #9
skmotay
Member
 
Location: MN

Join Date: Oct 2014
Posts: 29
Default

Well, that explains...a whole lot. And eases as much frustration!

(If only the data generator had left some notes or would return an email...)

I thought biological reps were unnecessary for RNA seq?
skmotay is offline   Reply With Quote
Old 10-09-2014, 10:38 AM   #10
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978
Default

Quote:
Originally Posted by skmotay View Post
I thought biological reps were unnecessary for RNA seq?
It is true that technical replicates are unnecessary but biological replicates are a must if you hope to get any meaningful results.
GenoMax is offline   Reply With Quote
Old 10-09-2014, 10:41 AM   #11
skmotay
Member
 
Location: MN

Join Date: Oct 2014
Posts: 29
Default

Yup, sorry I meant technical reps are unnecessary.
skmotay is offline   Reply With Quote
Reply

Tags
galaxy, paired end

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:43 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO