SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
can myrna build ref jar files from metazoa.ensembl.org databases? Gus RNA Sequencing 7 03-23-2011 01:01 PM
What do i do with the generated files? BRCA-DIAGNOSTIC andrehorta Bioinformatics 0 01-13-2011 02:01 AM
fastq files generated by Casava-Eland casava Bioinformatics 1 11-19-2010 04:56 AM
Error in GERALD - "Missing 'chromosome' element" Rachelly Illumina/Solexa 0 10-10-2010 05:47 AM
Advice on analyzing barcoded samples with GERALD/ELAND lparsons Illumina/Solexa 3 05-27-2009 09:02 AM

Reply
 
Thread Tools
Old 03-15-2011, 11:19 AM   #1
AdamB
Member
 
Location: uk

Join Date: Apr 2010
Posts: 43
Default FindPeaks SeparateReads.jar error using GERALD/ELAND-generated files

I'm trying to use FindPeaks with some data mapped in ELAND via GERALD. At the moment I'm stuck on using SeparateReads.jar. Below is a sample of the data from the input "s_X_sorted.txt" file:

Code:
HWI-EAS486	19	4	26	19288	17610	0	1	GCTTGTGTATCACTGGCGCAGCAGAGAGTCTGAGCATG	hhhhhhhhhghhhhhhfhfhcgdggcffchggfghfgh	chr10.fa		55	F	38131					
HWI-EAS486	19	4	65	12362	19698	0	1	CTGGTTAGAACAGCTAGGCCCTTGGGCCTCACTGTACA	hhhhhhghhhhhhhhhghhhhhhhhgfhhhhhhhfhhh	chr10.fa		145	F	38131					
HWI-EAS486	19	4	79	19730	5608	0	1	GCCAGCCTGGCAACTATCAGGCCACAAGGTGACATAAG	gggggggggdffc_fggggfc]ffWfcfadffffea_[	chr10.fa		309	F	19T18	88
I read in another thread that I could specify the aligner as "elandext", but to no avail. I get the following error message from SeparateReads.jar:

Code:
Version: Initializing class Log_Buffer                        $Revision: 2530 $
Version: Vancouver Short Read Analysis Package                4.0.16-dev.jars
Version: Initializing class SeparateReads                     $Revision: 3125 $
Version: Initializing class Generic_AlignRead_Iterator        $Revision: 3118 $
Version: Initializing class ElandExtIterator                  $Revision: 2933 $
Exception in thread "main" java.lang.StringIndexOutOfBoundsException: String index out of range: 38
	at java.lang.StringBuffer.setCharAt(StringBuffer.java:210)
	at src.lib.ioInterfaces.ElandExtUtilities.parse_mismatches(ElandExtUtilities.java:23)
	at src.lib.ioInterfaces.ElandExtIterator.next(ElandExtIterator.java:213)
	at src.lib.ioInterfaces.ElandExtIterator.next(ElandExtIterator.java:22)
	at src.lib.ioInterfaces.Generic_AlignRead_Iterator.hasNext(Generic_AlignRead_Iterator.java:121)
	at src.fileUtilities.SeparateReads.main(SeparateReads.java:70)
Is this a problem with the input file? I can't find any specification for the eland/elandext inputs for FindPeaks anywhere.
AdamB is offline   Reply With Quote
Old 03-25-2011, 06:25 AM   #2
apfejes
Senior Member
 
Location: Oakland, California

Join Date: Feb 2008
Posts: 236
Default

Hi Adam,

This may be a little more technically challenging, but would you be willing to compile and run from source? I suspect that this problem has been solved in the latest version, which has not yet been released.

I can help walk you through the process, if you're unsure how to do that. If not, I can email you a compiled version.

Anthony
__________________
The more you know, the more you know you don't know. —Aristotle
apfejes is offline   Reply With Quote
Old 03-25-2011, 07:22 AM   #3
AdamB
Member
 
Location: uk

Join Date: Apr 2010
Posts: 43
Default

Hi Anthony,

Yes I'd definitely like to try compiling the latest version. Is it on the website?

Thanks
AdamB is offline   Reply With Quote
Old 03-25-2011, 08:12 AM   #4
apfejes
Senior Member
 
Location: Oakland, California

Join Date: Feb 2008
Posts: 236
Default

It's available from the svn repository. There are instructions here: http://sourceforge.net/apps/mediawik...=VSRAPBuilding

use svn to get a copy of the source, and ant to build it (once you have ant and subversion installed)

__________________
The more you know, the more you know you don't know. —Aristotle
apfejes is offline   Reply With Quote
Old 03-31-2011, 03:19 AM   #5
AdamB
Member
 
Location: uk

Join Date: Apr 2010
Posts: 43
Default

I can confirm the latest version (4.0.17) successfully separated my reads using the "elandext" flag.

Thanks for your help.
AdamB is offline   Reply With Quote
Old 03-31-2011, 06:30 AM   #6
apfejes
Senior Member
 
Location: Oakland, California

Join Date: Feb 2008
Posts: 236
Default

Great, glad it's working!

Anthony
__________________
The more you know, the more you know you don't know. —Aristotle
apfejes is offline   Reply With Quote
Old 03-31-2011, 06:48 AM   #7
AdamB
Member
 
Location: uk

Join Date: Apr 2010
Posts: 43
Default

Small update: I tried to generate a wig file, which worked apart from that the chromosome name in the header was "chr1.fa". UCSC did not like this, so I changed the chromosome name to "chr1", and then it loaded okay. Do you know where the ".fa" part is coming from, and if it can be changed?

Thanks.
AdamB is offline   Reply With Quote
Old 03-31-2011, 07:09 AM   #8
apfejes
Senior Member
 
Location: Oakland, California

Join Date: Feb 2008
Posts: 236
Default

That's coming directly from your file - the aligner is using the name of the file as the chromosome. (You can even see it in the snippet you gave at the top of the thread for chr10.fa)

I seem to recall that there was a flag in FindPeaks to trim chromosome names and remove the .fa, but it escapes me what it would be. In the end, I think we just renamed all our .fa files to remove the extension and not have to worry about post processing our eland files.
__________________
The more you know, the more you know you don't know. —Aristotle
apfejes is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:12 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO