SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Error in bowtie's sam output? burt Bioinformatics 11 11-25-2012 03:53 PM
SAM output from bowtie/crossbow sethnr Bioinformatics 0 02-03-2012 01:56 AM
sam to Bowtie output seq_GA Bioinformatics 0 03-21-2011 10:56 PM
Sorting SAM output from Bowtie DrD2009 Bioinformatics 9 11-10-2010 11:52 AM
SAM output from Bowtie >50GB? jjw14 Bioinformatics 9 06-27-2010 02:30 PM

Reply
 
Thread Tools
Old 12-03-2009, 10:30 AM   #1
rdeborja
Member
 
Location: Toronto

Join Date: Aug 2008
Posts: 42
Default Bowtie and SAM output

I've encountered an interesting situation with Bowtie outputting SAM format files. I'm working with some data from an Illumina run. After aligning the data using bowtie 0.11.3 and outputting the results into SAM format, I noticed that any of the reads that align to multiple sections of the genome are identified as unique reads in the SAM file (read 1 has bitwise flag value 99 and read has bitwise flag value 147). Taking the sequence and blatting it results in reads that align in multiple locations on the mouse reference.

Here are the input reads, my bowtie statement and the subsequence SAM output file:

Read 1
@I095:1:1:27:799#0/1
CATTCTCATGCCAAAGCATTGCTGCTTCCATCACACTTGGAAGTCGTCTGTTTTGCTCAACTCTTTTATTTCTACT
+I095:1:1:27:799#0/1
a^aab``XZQ[ZSRWK\__]Wa_Xa_Y]]T^a`_Z_YVJJNULX_UZ_TDL^]`VX\VNX]``a`a`TZ^^^[RSY

Read 2
@I095:1:1:27:799#0/2
GTTGGCATACTGGGAACCAGTCTCTTCATTTTCCCTATGCATGTTTTTTTTTTCCATCCTTCCTATTCTCCTATCT
+I095:1:1:27:799#0/2
aa^MO]\_a`YMMOZ`ab_a\aabaa_]_]TF\`_]TVFX]a___aaZFV_^`Z___aa__ba`U_^^\[[ZRZ\[

Bowtie command:
bowtie <mouse_reference> --solexa1.3-quals -1 s_3_1_sequence.txt -2 s_3_2_sequence.txt -S test.sam

The SAM file result is as follows:
I095:1:1:32:909#0/1 99 chr13 25412668 255 76M = 25412818 226 ATAAAATACCTTGGCGTGACTCTAACTAAGGAAGTGAAAGATCTGTATGATAAGAACTTCAAGTCTCTGAAGAAAG aaaaaa`V\^YVSN_RXLY`abaaa`XYTKMX]UZPP[QNT^a`XZ`[KZ^^OFLY\[^``RW]abb_BBBBBBBB XA:i:1 MD:Z:8T44A22 NM:i:2
I095:1:1:32:909#0/2 147 chr13 25412818 255 76M = 25412668 -226 GCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATTCCCATAAAAATTCCAAGTCAATTCTTCAACGAATTAG BBBBBBBBBBB_a`aa`a_\NYVMW^[OVDW```V_^ZRFUFYVG^_`a\T[aa\HXaba]XQWVO^]Q_aa]_ba XA:i:0 MD:Z:38C5C31 NM:i:2

Has anyone else encountered an issue where bowtie is returning a read in the repeat region but reporting it as unique?

Last edited by rdeborja; 12-03-2009 at 10:32 AM.
rdeborja is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:56 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO