SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
RNA-seq multiplexing sppearce Sample Prep / Library Generation 1 08-05-2011 04:13 AM
Multiplexing without indexing sequencing spenserbsmith Sample Prep / Library Generation 6 12-15-2010 09:59 AM
Multiplexing prep. James Sample Prep / Library Generation 0 09-27-2010 03:15 AM
multiplexing smallRNA moguin Illumina/Solexa 7 09-16-2010 02:06 PM
Multiplexing bioinfosm Illumina/Solexa 0 09-24-2008 09:05 AM

Reply
 
Thread Tools
Old 12-01-2011, 03:13 PM   #1
attila.szanto
Junior Member
 
Location: Boston

Join Date: Oct 2011
Posts: 2
Default Multiplexing

Can anyone please check the following seq if it could work for a multiplexing PCR product?

AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT NNNNNN AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC NNNNNN ATCTCGTATGCCGTCTTCTGCTTG
TTACTATGCCGCTGGTGGCTCTAGA TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA NNNNNN TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG NNNNNN TAGAGCATACGGCAGAAGACGAAC


Also, I would appreciate if someone could tell me why there is a difference between PE PCR Primer 2.0 and Multiplexing PCR Primer 2.0. I mean between the middle part:

CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACC GCTCTTCCGATCT and the
----------------------------GTGACTGGAGTTCAGACGTGT GCTCTTCCGATCT
attila.szanto is offline   Reply With Quote
Old 12-02-2011, 07:15 AM   #2
cascoamarillo
Senior Member
 
Location: MA

Join Date: Oct 2010
Posts: 158
Default

It's easy to check if you do a little of research. What I see is a standard Illumina RNA-seq library ready for multiplexing; with the read primer 1 (Rd1 SP) region, the index SP primer and the read primer 2 (Rd2 SP).

I'm not sure about the other primers you mention, couldn't find any match with what I have. Are they for DNA, RNA-seq, smallRNA...?
cascoamarillo is offline   Reply With Quote
Old 12-02-2011, 07:32 AM   #3
attila.szanto
Junior Member
 
Location: Boston

Join Date: Oct 2011
Posts: 2
Default

Thanks. The confusion came from the difference between the two illumina primers I mentioned (PE PCR Primer 2.0 and Multiplexing PCR Primer 2.0). The first one is for regular paired end seq and the other is for multiplexing. So, I had to design my oligos, so that I could do paired end seq and also include a barcode to filter out pcr artifacts. And I followed the logic of the standard illumina multiplexing oligos. However, instead of using 3 primers in the pcr, I add the barcode to the adapters. And just want to double check if the library ready for seq has the right sequences to bind to the flow cell and also to seq with Multiplexing Read 1, Read 2 and Index Read primers. I could find such a sequence only for PE but not for multiplexing.
Anyway, thanks for your help.
attila.szanto is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:34 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO