Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
tophat mapping bug? cedance Bioinformatics 2 11-11-2011 07:56 AM
Sequence direction in alignment newbietonextgen Bioinformatics 1 01-18-2011 11:41 AM
restriction endonuclease detection manishbudathoki General 2 10-21-2010 12:02 PM
OpGen: Optical Restriction Mapping as replacement for Mate Pair Sequencing? ECO General 2 09-30-2010 06:00 AM
Restriction digest of RNA /DNA hybrid Gillow Sample Prep / Library Generation 1 07-09-2010 05:27 AM

Thread Tools
Old 12-27-2009, 06:23 AM   #1
Location: Berlin

Join Date: Oct 2009
Posts: 10
Default Bowie12Beta mapping direction restriction or bug?

Dear all, I was trying to map 76nt reads using Bowtie. I wanted to use the "seed" feature to avoid trimming off the adapter sequence.

1) this is the sequence that I trimmed off the last "4nt" long "adapter", which is not really the adapter, and I got it mapped.
HWUSI-EAS1621. 16 chr1 173833971 255 72M * 0 0 CATCAGATAGGAGCGAAAGACTTAATATTGCTCATCAGCGTTAGTCTGCTGAACTATGTTATCATCATTGTA ;:;143>>=9:>:[email protected]@@=B<[email protected]@;?0>BA8>[email protected]@ABB<BBBABBAA?:?BACCBABB XA:i:0 MD:Z:72 NM:i:0

2) so now I map the non-trimmed 76nt sequence, it turned out unmapped.
HWUSI-EAS1621. 4 * 0 0 * * 0 0 TACAATGATGATAACATAGTTCAGCAGACTAACGCTGATGAGCAATATTAAGTCTTTCGCTCCTATCTGATGATCT BBABCCAB?:?AABBABBB<[email protected]@A>8AB>0?;@[email protected]<[email protected]@@BABB?A87B?A=+:>:9=>>341;:;<919 XM:i:0

my parameters: -q -n 3 -l 30 -k 10 --solexa1.3-quals --best -S -y
So here is the thing: the seed length is 30nt, and is a perfect match(on reverse strand), so it ought to be reported. But why not?

Thanks in advance!
arthur.yxt is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 09:50 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO