SEQanswers

Go Back   SEQanswers > General



Similar Threads
Thread Thread Starter Forum Replies Last Post
TruSeq adapter sequences? BIG_SNP Illumina/Solexa 35 03-16-2014 06:21 PM
TruSeq adapter sequences kirankm Sample Prep / Library Generation 4 05-10-2012 07:32 AM
SOLiD Adapter Sequences DrDTonge SOLiD 0 08-25-2011 01:14 AM
primer/adapter sequences nikiwilson Sample Prep / Library Generation 2 06-21-2011 02:36 PM
About illumina's adapter sequences Alex.yang Illumina/Solexa 0 08-27-2010 08:56 AM

Reply
 
Thread Tools
Old 04-17-2009, 07:14 AM   #1
SeqTruth
Member
 
Location: South Africa

Join Date: Apr 2009
Posts: 12
Default Adapter sequences

I'm looking for the sequences of both the 454 FLX and the Titanium library adapters. I'd also be interested to know the adapter sequences of any of the other platforms.

Thanks!
SeqTruth is offline   Reply With Quote
Old 04-21-2011, 01:28 AM   #2
qkdlspf
Junior Member
 
Location: 236

Join Date: Mar 2011
Posts: 6
Default

I'd also like to know the adaptor sequences.
qkdlspf is offline   Reply With Quote
Old 04-27-2011, 08:05 AM   #3
begsch
Junior Member
 
Location: France

Join Date: Jul 2009
Posts: 7
Default

--> http://seqanswers.com/forums/showthread.php?t=4819

Quote:
Originally Posted by AKroxy View Post
Here is the info I got from the Roche rep when I asked for the RAPID adaptor sequences so I could design PCR primers.

The adaptors are double stranded. The sequences TCAG at 3' end of each long adaptor strand are the general Ti shotgun key sequences. The key sequence is different with Rapid Library. The following figure will help in explaining better. You can order the Primers below to check your library.

emPCR Primer A 5' CCATCTCATCCCTGCGTGTC 3'
TI A Adaptor 5' CCATCTCATCCCTGCGTGTCTCCGACTCAG 3'
3' AGAGGCTGAGTC 5'

emPCR Primer B 5' CCTATCCCCTGTGTGCCTTG 3'
TI B Adaptor 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG 3'
3' ACCGTCAGAGTC 5'
begsch is offline   Reply With Quote
Reply

Tags
454, adapters, adaptors

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:35 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO