SEQanswers

Go Back   SEQanswers > General



Similar Threads
Thread Thread Starter Forum Replies Last Post
Problem with quality of TILE barthez95 Illumina/Solexa 0 05-30-2018 12:31 PM
Poor per tile sequence quality cd1 Illumina/Solexa 4 06-27-2017 01:08 PM
Quality per tile starbug Illumina/Solexa 0 09-20-2016 12:17 PM
tile nomenclature tomc Illumina/Solexa 8 04-19-2012 06:41 AM
Sample tile images across a lane ScottC Illumina/Solexa 4 07-06-2008 02:14 PM

Reply
 
Thread Tools
Old 04-02-2019, 03:48 PM   #1
jmlabioinfo
Junior Member
 
Location: USA

Join Date: Apr 2019
Posts: 1
Unhappy Tile is missing

Hi all,

I received some fastq files from a PE HiSeq and when I tried to isolate N reads using the "fastq_illumina_reads -N" I got the following error:

Input error: file 'STDIN' line 1: Expecting Illumina-CASAVA1.8 ID line structure (@<instrument>:<run number>:<flowcell ID>:<lane>:<tile>:<x-pos>:<y-pos> <read>:<is filtered>:<control number>:<index sequence>) - got '@HS34_23148:4:1313:16347:42480/1' (Can't extract 'Tile’)



The header of the file shows:
@HS34_23148:4:2106:12625:73859/2
CACCAGCTGAGAGAGATGCTCGCCGTTGACTGACGAACTGAATTCCCAGTTCACGGCGGTATGGAATACCGTCGT
+
BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@HS34_23148:4:1114:12855:77248/2
CTCGCCGTTGACTGACGAACTGAATTCCCAGTTCACGGCGGTATGGAATACCGTCGTCGCAGAGCTCAACGGTGA
+
BBBBBFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFF
@HS34_23148:4:1311:2663:94744/2
CTCGACAGATATTGATTGTCGTCACCGTTGAGCTCTGCGACGACGGTATTCCATACCGCCGTGAACTGGGAATTC

Does anyone already get the same problem with the tile coordinates?
(I could ask the facility who sent me the files an explanation but I'm not sure if the problem come from me or not)

Thank you
jmlabioinfo is offline   Reply With Quote
Old 04-03-2019, 01:12 PM   #2
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,158
Default

Quote:
Originally Posted by jmlabioinfo View Post
Hi all,

I received some fastq files from a PE HiSeq and when I tried to isolate N reads using the "fastq_illumina_reads -N" I got the following error:

Input error: file 'STDIN' line 1: Expecting Illumina-CASAVA1.8 ID line structure (@<instrument>:<run number>:<flowcell ID>:<lane>:<tile>:<x-pos>:<y-pos> <read>:<is filtered>:<control number>:<index sequence>) - got '@HS34_23148:4:1313:16347:42480/1' (Can't extract 'Tile’)



The header of the file shows:
@HS34_23148:4:2106:12625:73859/2
CACCAGCTGAGAGAGATGCTCGCCGTTGACTGACGAACTGAATTCCCAGTTCACGGCGGTATGGAATACCGTCGT
+
BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@HS34_23148:4:1114:12855:77248/2
CTCGCCGTTGACTGACGAACTGAATTCCCAGTTCACGGCGGTATGGAATACCGTCGTCGCAGAGCTCAACGGTGA
+
BBBBBFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFF
@HS34_23148:4:1311:2663:94744/2
CTCGACAGATATTGATTGTCGTCACCGTTGAGCTCTGCGACGACGGTATTCCATACCGCCGTGAACTGGGAATTC

Does anyone already get the same problem with the tile coordinates?
(I could ask the facility who sent me the files an explanation but I'm not sure if the problem come from me or not)

Thank you
It looks like you got hold of a very old (in Illumina time scale) FastQ file. Have a look at the Illumina sequence identifiers discussion on the FastQ format Wikipedia page. The sequence headers in your file are the pre-CASAVA 1.8 format. The software you are trying to use (fastq_illumina_reads) is expecting the header format to be the post-CASAVA 1.8 format. I can't remember when that format version was first introduced but it was years ago.

What software package is the fastq_illumina_reads program from? Does it have a command line option to switch between the old and new FastQ sequence ID line formats?
kmcarr is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:47 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO