[gwilkie]

GapFiller is now working thanks to our wonderful Bioinformatics people

The software was looking in the wrong folder for bwa, so they changed to script for me and now it points to the correct place on our server.

Initial testing shows that GapFiller is much, much faster than IMAGE and it is also easier to run and interpret the results. Top stuff, and thanks to the developers. I'll be using this a lot to improve my assemblies!

Cheers, Gavin

[gwilkie]

Not only is GapFiller faster and easier to run than IMAGE, my initial testing also shows that it closes more gaps in my assemblies. Excellent!

[namigrt]

I've been trying to get GapFiller working on a number of Illumina assemblies that we have in my lab, but I'm not getting all of the output files that the manual says I should.

I ran the tutorial on the scaffolds in the example/ folder using the stipulated read sets, but I never get the following output files: XXX.filler.final.text, XXX.closed.evidence.txt, XXX.gapfilled.final.fa.

I do get the following files: XXX.summarfile.final.txt, XXX.gapclosure.fa and a bwa logfile in alignoutput/ and an empty XXX.closed.evidence.iteration1.txt file in intermediate_results/.

Has anyone else had this problem or have any suggestions for getting the correct output files?

Hi

Im trying to use GapFiller program and am facing the same problem. Was this issue solved. If yes, could you please let me know what the issue was.

Thanks

[MPatel]

GapFiller Stops after 1st ITERATION

Hello,

I am new to this thread. I have been using SSPACE for scaffolding and its been fantastic. Now I am trying GapFiller to close the gaps in scaffolds. But some how it stops after 1st Iteration on Mac OS 10.7 however it runs smoothly on linux with the same parameters.

I dont know why its not working on Mac.

Any ideas....

Thank you...

MPatel

[boetsie]

I think it has something to do with the user rights of bowtie/bwa.

[MPatel]

Thank you boetsie.

I will give a try changing bowtie/bwa execution permissions. let see if it works.

[MPatel]

Hello boetsie,

Its working smoothly now. I have downloaded bwa and bowtie and it worked.

Thank you.

[jvilj]

I have been trying to get GapFiller to run, but I get the same error as Stepa_t.

It stops at iteration 1 after printing
=>Thu Jul 11 16:49:06 2013: Mapping reads to scaffolds, reading alignment output and storing reads

In the tmpbwa_logfile
Bwa error; -1 at /software/bin/GapFiller line 218.

Can anyone assist - is it failing to find bwa? bwa is installed on our BioLinux system but perhaps GapFiller is looking in the wrong place?

It appears that GapFiller expects `bwa` to be in the folder that it was called from. I've changed `GapFiller.pl` at line 212 from

my $bwapath = "$Bin"."/bwa/bwa";

to

my $bwapath = "bwa";

(since `bwa` is on my path), and it is running smoothly now. I guess one could also specify the full path to `bwa`, e.g. "~/src/bwa-0.7.5a/bwa".

@CPCantalapiedra @gwilkie: Thanks for pointing me in the right direction!

@boetsie: Thanks for the nice software!

[shuixia100]

Hi Marten,

Thanks for the tool for gap filling. However, I had some problem running it , basically the problem is it stopped at the the bowtie-build which is the first step of bowtie. I checked the align output file, it turned out that asem1.contig.gpfill.gapclosure.fa is empty. I tried to read through your perl script but failed to understand how asem1.contig.gpfill.gapclosure.fa is generated so I couldn't figure out why this is empty. Could you please let me know the possible reason of it? Thank you very much!

-rw-r--r-- 1 users 40 2013-03-08 06:10 asem1.contig.gpfill.bowtieIndex.1.ebwt
-rw-r--r-- 1 users 4 2013-03-08 06:10 asem1.contig.gpfill.bowtieIndex.2.ebwt
-rw-r--r-- 1 users 0 2013-03-08 06:10 asem1.contig.gpfill.gapclosure.fa



perl ~/bin/GapFiller_v1-11_linux-x86_64/GapFiller.pl -l libraries -s asem1.contig -m 30 -o 3 -r 0.7 -n 10 -d 50 -t 0 -g 0 -T 1 -i 1 -b asem1.contig.gpfill

Your inserted inputs on [GapFiller_v1-11_Final] at Fri Mar 8 05:37:25 2013:
-s asem1.contig
-l libraries
-b asem1.contig.gpfill
-o 3
-m 30
-r 0.7
-n 10
-T 1
-g 0
-d 50
-t 0
-i 1


=>Fri Mar 8 05:37:25 2013: Reading and processing paired-read files

ITERATION 1:

=>Fri Mar 8 06:10:25 2013: Mapping reads to scaffolds, reading alignment output and storing reads
Warning: Empty input file
Reference file does not seem to be a FASTA file
Command: /home/bin/GapFiller_v1-11_linux-x86_64/bowtie/bowtie-build --quiet --noref asem1.contig.gpfill/alignoutput/asem1.contig.gpfill.gapclosure.fa asem1.contig.gpfill/alignoutput/asem1.contig.gpfill.bowtieIndex

Bowtie-build error; 256 at /home/bin/GapFiller_v1-11_linux-x86_64/GapFiller.pl line 242.

I am having same problem. did you figure out how to fix it?

[Dagga]

Thanks for the tips! I have finally got this program working.

I was wondering if anyone has any tips on a starting region for the error settings that are inputted into the library file.

I have a bacterial genome approximately 9Mb in size using an insert size of ~400-500.

I know it will be variable but I was just after a good place to start. I noticed the manual uses 0.25 but this is with an insert size of 1000.

Anyway, any opinions on where to start would be helpful thanks!

[RhiP]

error - invalid fastq

I am receiving an error when running SSPACE to get a scaffold for GAPfiller.
"ERROR: Invalid file in library Lib1: ~/scratch/bob/lotus/Illumina_3kb_1_R1.fastq -- fatal"

Below is what the head of my fastq file looks like and I don't see where there may be a formatting error. Has anyone else seen and fixed this error?

@DBRHHJN1:175:C011MACXX:3:1101:1149:1049 1:N:0:ATCACG
TCAGGGCATTTTTTGATGCTTCACATTCCTTATGG
+
;@@DDDDBHF?HAHCAFEEFF<<9CDDGEGHCFGF
@DBRHHJN1:175:C011MACXX:3:1101:1087:1093 1:N:0:ATCACG
TCACGAGTCAAGCTAACATAGCTTGTGAAAAGCCT
+
@@@FFDDD>DFHFFEEEGHIIEHHIIH@GGGGGEH

Thanks!

[DAPOR]

Hi,

I am am trying to use GapFiller. I succeed to run the test and everything works fine. The problems start when I try to use my data (of course). I have a 250 bp paired-end data in fastq file and the scaffold (in fasta) from SSPACE. When I run the command for GapFiller it seems that it does not load the fastq reads and I get this output.

""
Your inserted inputs on [GapFiller_v1-10] at Thu Jun 26 10:17:35 2014:
-s En.hirae_INFE1.fa
-l libraries.txt
-b test
-o 2
-m 30
-r 0.7
-n 10
-T 1
-g 1
-d 50
-t 10
-i 3


=>Thu Jun 26 10:17:35 2014: Reading and processing paired-read files

ITERATION 1:

=>Thu Jun 26 10:17:47 2014: Mapping reads to scaffolds, reading bowtie output and storing unmapped reads

=>Thu Jun 26 10:17:47 2014: Building BWA index for library lib1

=>Thu Jun 26 10:17:47 2014: Filling gaps

Closed 0 out of 0 gaps
Closed 0 out of 0 nucleotides

All gaps are closed. Exiting...

Process run successfully on Thu Jun 26 10:17:52 2014 in 0 minutes and 17 seconds
""

The fastq files are in the folder together with the library.txt file and the name is correct in the library.txt file.
This happen when I use bwa. If I use bowtie I get this error (like others):

Bowtie-build error; 256 at /Users/davipo/Desktop/fastq-tools/GapFiller_v1-10_/GapFiller.pl line 242.


If I run the test it works with both bowtie and bwa.

Someone knows what I do wrong?

Thanks

Davide

[stepa_t]

Hi Davide,

I had the same issue when started to use GF. As I recall I've downloaded bowtie folder just from bowtie site ( bowtie-bio.sourceforge.ne ) and replaced "bowtie" folder in SSPACE folder.

Hope that helps.
Cheers,
Stepan

[DAPOR]

Hi Davide,

I had the same issue when started to use GF. As I recall I've downloaded bowtie folder just from bowtie site ( bowtie-bio.sourceforge.ne ) and replaced "bowtie" folder in SSPACE folder.

Hope that helps.
Cheers,
Stepan

Hi Stepan

Thanks. I tried again to download bowtie from the website and it works with another genome. I think I have some problem with the genome I was working before. I will try to fix it.

Davide

[Tom_C]

Hello all,

I would like to use GapFiller, however am receiving the following error when running the command for Gapfiller:

-bash: ./GapFiller.pl: /usr/bin/perl^M: bad interpreter: No such file or directory

I am not quite computer savvy enough to figure this one out, anyone else getting this message?