SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Displaying DGE (bed-files) with Integrative Genomics Viewer Azazel Bioinformatics 1 09-01-2011 07:58 PM
Genomics Core Laboratory Technician, NYU Center for Genomics and Systems Biology scheidp Academic/Non-Profit Jobs 0 08-15-2011 09:29 AM
RNA-Seq: An integrative approach to genomic introgression mapping. Newsbot! Literature Watch 1 08-05-2010 06:42 AM
ChIP-Seq: Next-generation genomics: an integrative approach. Newsbot! Literature Watch 0 06-10-2010 02:00 AM
PubMed: Integrative analysis of the melanoma transcriptome. Newsbot! Literature Watch 2 04-20-2010 02:55 PM

Reply
 
Thread Tools
Old 12-13-2011, 04:25 PM   #1
magarine
Junior Member
 
Location: South Korea

Join Date: Sep 2010
Posts: 5
Default some problems in using integrative genomics viewer

Hi all.
I want to use IGV for viewing my BAM file data which I generated by Hiseq2000.
Using ELANDv2, the data was aligned to hg18 and called SNP and small IN/DEL.
However, when I open the BAM file as output data of ELANDv2 on IGV, any data is not shown.
As searching the reason, I could find this suggestion - http://www.broadinstitute.org/softwa...ata/#aliasfile
So, I made the alias file and located the location that page mentioned.
But, the result is same with before.
Is anyone help me?
Below is my sample SAM data.

@HD VN:1.0 SO:coordinate
@PG ID:CASAVA VN:CASAVA-1.8.1 CL:/usr/local/bin/configureBuild.pl --id /illumina2/data/111020_SN336_0133_AB0BEYABXX/Data/Intensities/BaseCalls/Aligned/Project_A --od /illumina2/data/111020_SN336_0133_AB0BEYABXX/Data/Intensities/BaseCalls/VariantProjectA --ref /data/pub_data/hg18 -f
@SQ SN:chr1.fa LN:247249719
@SQ SN:chr2.fa LN:242951149
@SQ SN:chr3.fa LN:199501827
@SQ SN:chr4.fa LN:191273063
@SQ SN:chr5.fa LN:180857866
@SQ SN:chr6.fa LN:170899992
@SQ SN:chr7.fa LN:158821424
@SQ SN:chrX.fa LN:154913754
@SQ SN:chr8.fa LN:146274826
@SQ SN:chr9.fa LN:140273252
@SQ SN:chr10.fa LN:135374737
@SQ SN:chr11.fa LN:134452384
@SQ SN:chr12.fa LN:132349534
@SQ SN:chr13.fa LN:114142980
@SQ SN:chr14.fa LN:106368585
@SQ SN:chr15.fa LN:100338915
@SQ SN:chr16.fa LN:88827254
@SQ SN:chr17.fa LN:78774742
@SQ SN:chr18.fa LN:76117153
@SQ SN:chr19.fa LN:63811651
@SQ SN:chr20.fa LN:62435964
@SQ SN:chrY.fa LN:57772954
@SQ SN:chr22.fa LN:49691432
@SQ SN:chr21.fa LN:46944323
@SQ SN:chrM.fa LN:16571
HWI-ST336_133:2:1208:9721:194569 137 chr1.fa 10 25 22M1D17M1D60M * 0 0 CCCTAACCCTAACCCTAACCCTACCCTAACCCTAACCCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCAA CCFFFFFHHGHHJJJJJJJJJJJDHI?:C8DH8?FEHI>?D@G3?BBCGCB=C@FD7@@?C=?EBDFBCCEAC=?AD;(9?<9<?<938<A8<?##### BC:Z:0 XD:Z:22^A$17^A$60 SM:i:25 AS:i:0
HWI-ST336_133:2:1208:9721:194569 69 chr1.fa 10 0 * =10 0 TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGATAGGGATAGGGCTGGGGTGGGGGTTCGGTGTG @@DFFFDHDHHHFHFEHIGIGIIHGIGGGIIG?GGHBF9DACBAFFGGCB6=>CDE########################################### H0:i:255 H1:i:135 H2:i:83 BC:Z:0
HWI-ST336_133:4:2101:19741:191800 153 chr1.fa 12 11 99M *0 0 CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCAA ################???95(BA;(5(?CA?;6BED?C=HC@(D=IHF=C=EBB289BGF@D9IIHGF?IGGDF?HEECA?JIIIIHGHHHDADDDB? BC:Z:0 XD:Z:99SM:i:11 AS:i:0
magarine is offline   Reply With Quote
Old 12-13-2011, 10:36 PM   #2
hanshart
Member
 
Location: Germany

Join Date: Nov 2011
Posts: 27
Default

Hi,

From http://www.broadinstitute.org/software/igv/BAM:
Quote:
Indexing: IGV requires that both SAM and BAM files be sorted by position and indexed
You can use samtools for sorting and indexing the BAM file using the commands
Code:
samtools sort aln.bam aln.sorted
samtools index aln.sorted.bam
Maybe this helps

cheers
hanshart is offline   Reply With Quote
Old 12-13-2011, 11:10 PM   #3
magarine
Junior Member
 
Location: South Korea

Join Date: Sep 2010
Posts: 5
Default

Thanks Hanshart.

Actually, ELAND's result has sorted.bam and sorted.bam.bai file.

Please I need your help. experts.
magarine is offline   Reply With Quote
Old 12-14-2011, 06:35 AM   #4
Alex Renwick
Member
 
Location: Houston, Texas

Join Date: Jul 2011
Posts: 44
Default

Does IGV show any error message?

Be sure you're using the sorted.bam file. IGV will find the associated index file from the name and ".bai" extension, but it won't go looking for the sorted file if you give an unsorted one.

One possibility is that you need to zoom in. At the whole genome level nothing is shown. The data doesn't show up until the window is zoomed so that the window spans less than 50kb.
Alex Renwick is offline   Reply With Quote
Old 12-14-2011, 03:25 PM   #5
magarine
Junior Member
 
Location: South Korea

Join Date: Sep 2010
Posts: 5
Default

Thanks Alex Renwick.

Your point is correct.
When I zoomed window as soon as install and data load, the computer was down by unexpected error.
But, now IGV works well.

Thank you for your advise and help.
magarine is offline   Reply With Quote
Reply

Tags
igv eland

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:26 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO