Hi,
I have done a bacterial genome sequencing using PacBio SMRT Sequencing, and I have done the assembly, checking its circularity followed by performing base modification analysis. I have submitted the complete genome to NCBI. Now, I have a .gff file, which contain the position of the bases which might have been modified (i.e. methylated) as shown below (in .csv format)
scf7180000000004,quiver_2014001-4028001,quiver,kinModCall,m6A,970,970,58,-,.,context=CGTCGGTCGTGCGCAGCCACAGCGCGCCTTCCTGCTCGTAG;fracLow=0.770;motif=CACAG;coverage=27;IPDRatio=6.79;id=CACAG;fracUp=1.000;frac=0.985;identificationQv=35
In which this line indicated at position 970, the base A has been methylated.
May I know, what should I do to know the modified base falls on the coding or non-coding sequences? I have the genbank file as well as other relevant file that i can download from NCBI.
Thanks.
Regards,
Kar Wai
I have done a bacterial genome sequencing using PacBio SMRT Sequencing, and I have done the assembly, checking its circularity followed by performing base modification analysis. I have submitted the complete genome to NCBI. Now, I have a .gff file, which contain the position of the bases which might have been modified (i.e. methylated) as shown below (in .csv format)
scf7180000000004,quiver_2014001-4028001,quiver,kinModCall,m6A,970,970,58,-,.,context=CGTCGGTCGTGCGCAGCCACAGCGCGCCTTCCTGCTCGTAG;fracLow=0.770;motif=CACAG;coverage=27;IPDRatio=6.79;id=CACAG;fracUp=1.000;frac=0.985;identificationQv=35
In which this line indicated at position 970, the base A has been methylated.
May I know, what should I do to know the modified base falls on the coding or non-coding sequences? I have the genbank file as well as other relevant file that i can download from NCBI.
Thanks.
Regards,
Kar Wai