SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > SOLiD



Similar Threads
Thread Thread Starter Forum Replies Last Post
Exclude variants in certain regions OlgaMikh Bioinformatics 2 02-12-2012 12:20 PM
Stand Alone Blast Exclude without -remote tboothby Bioinformatics 1 02-04-2012 04:03 AM
Deep seq for ncRNA Shizuka Introductions 0 04-28-2011 02:05 AM
how to exclude the known ncRNA EADIE Bioinformatics 0 11-16-2010 12:40 AM
ncRNA targets NicoBxl Bioinformatics 2 09-22-2010 05:24 AM

Reply
 
Thread Tools
Old 11-14-2010, 05:56 AM   #1
EADIE
Member
 
Location: CHINA

Join Date: Mar 2010
Posts: 11
Default how to exclude the known ncRNA

I have some data of Arabidopsis for small RNA analysis. Now i want to do a locall alignment with Rfam then exclude the sequences which match to Rfam from futher analysis. But the question is:
Do i need to extract the relevant Arabidopsis members of the Rfam before alignning? If it's best to do that, how should i deal with members with no species name? Do they also need to extract for matching? These members are as follows:

>RF00005;tRNA;AAVX01183092.1/735-806 :
GTCCCATAGCATTGTGGTTTGCGTATTCGCCTTGCAAGCGAGAGGATCTG
GGTTCGATTCCCAGGTGGGGCA
>RF00005;tRNA;AAVX01300616.1/338-420 :
GTAGTTGTGGCTGAGTGGTTAAGACAATGGACTAGAAATCCACTAGAAAA
CTACCCGCGCAGGTTCGAATCCTGCAGACTACG
>RF00005;tRNA;AAVX01004056.1/1665-1747 :
GAAGTATTGGCCGAGTGGCGAAGGCGATGGACTACAAATCCATTGAGAAA
CTTCCCGCGCTGTTTCGAATCCTGCCGACTACG

Looking forward to your reply~~
Thank you in advance!
EADIE is offline   Reply With Quote
Old 11-15-2010, 07:43 AM   #2
KevinLam
Senior Member
 
Location: SEA

Join Date: Nov 2009
Posts: 199
Default

Sounds like a generic qn. Perhaps u may wish to move ur thread to the bioinfomatics subforum?
KevinLam is offline   Reply With Quote
Old 11-16-2010, 12:43 AM   #3
EADIE
Member
 
Location: CHINA

Join Date: Mar 2010
Posts: 11
Default

Quote:
Originally Posted by KevinLam View Post
Sounds like a generic qn. Perhaps u may wish to move ur thread to the bioinfomatics subforum?
KevinLam, thanks for your advice!
EADIE is offline   Reply With Quote
Old 11-16-2010, 01:43 PM   #4
bioinfosm
Senior Member
 
Location: USA

Join Date: Jan 2008
Posts: 482
Default

I used ncrna.org, but that was for human data. Probably they have arabidopsis as well
__________________
--
bioinfosm
bioinfosm is offline   Reply With Quote
Old 11-17-2010, 06:01 AM   #5
EADIE
Member
 
Location: CHINA

Join Date: Mar 2010
Posts: 11
Default

Quote:
Originally Posted by bioinfosm View Post
I used ncrna.org, but that was for human data. Probably they have arabidopsis as well
Thanks for your information!
EADIE is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:26 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO