SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Exclude variants in certain regions OlgaMikh Bioinformatics 2 02-12-2012 12:20 PM
Stand Alone Blast Exclude without -remote tboothby Bioinformatics 1 02-04-2012 04:03 AM
Deep seq for ncRNA Shizuka Introductions 0 04-28-2011 02:05 AM
how to exclude the known ncRNA EADIE SOLiD 4 11-17-2010 06:01 AM
ncRNA targets NicoBxl Bioinformatics 2 09-22-2010 05:24 AM

Reply
 
Thread Tools
Old 11-16-2010, 12:40 AM   #1
EADIE
Member
 
Location: CHINA

Join Date: Mar 2010
Posts: 11
Default how to exclude the known ncRNA

I have some data of Arabidopsis for small RNA analysis. Now i want to do a locall alignment with Rfam then exclude the sequences which match to Rfam from futher analysis. But the question is:
Do i need to extract the relevant Arabidopsis members of the Rfam before alignning? If it's best to do that, how should i deal with members with no species name? Do they also need to extract for matching? These members are as follows:

>RF00005;tRNA;AAVX01183092.1/735-806 :
GTCCCATAGCATTGTGGTTTGCGTATTCGCCTTGCAAGCGAGAGGATCTG
GGTTCGATTCCCAGGTGGGGCA
>RF00005;tRNA;AAVX01300616.1/338-420 :
GTAGTTGTGGCTGAGTGGTTAAGACAATGGACTAGAAATCCACTAGAAAA
CTACCCGCGCAGGTTCGAATCCTGCAGACTACG
>RF00005;tRNA;AAVX01004056.1/1665-1747 :
GAAGTATTGGCCGAGTGGCGAAGGCGATGGACTACAAATCCATTGAGAAA
CTTCCCGCGCTGTTTCGAATCCTGCCGACTACG

Looking forward to your reply~~
Thank you in advance!
EADIE is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:14 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO