Dual indexing construct for MiSeq - where to put the barcode for index2?

[ThePhotosyntheticMan]

Originally Posted by TonyBrooks

I think both should work.
The Illumina read primer is actually a primer mix of several primers. I guess there's probably primers for both sequences in there (TruSeq and Nextera).

However, if you're generating library directly from PCR, why not remove those sequences all together and just use custom read primers. Your custom read primers will just be versions of your fwd and rev primer sequences. You'll also waste less reagent by not sequencing your primers. See my post further up.

Got it. Thanks!

[gnomers]

Originally Posted by TonyBrooks

I think both should work.
The Illumina read primer is actually a primer mix of several primers. I guess there's probably primers for both sequences in there (TruSeq and Nextera).

However, if you're generating library directly from PCR, why not remove those sequences all together and just use custom read primers. Your custom read primers will just be versions of your fwd and rev primer sequences. You'll also waste less reagent by not sequencing your primers. See my post further up.

We've been using custom read primers on an amplicon library successfully on the HiSeq. However, we just tried the exact same strategy on the MiSeq and it failed utterly (nothing but PhiX in the first (index) read.)

Are the annealing temperatures very different on the HiSeq and MiSeq?

[TonyBrooks]

See this document (taken from an Illumina bulletin on their website).

[uberfinch]

I used the following adapters on our MiSeq:

N701:
CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

N501:
AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

It didn't detect clusters (I used the provided sequencing primers).

Anyone have any ideas of what went wrong? I'm dumbfounded.

[pmiguel]

Originally Posted by uberfinch

I used the following adapters on our MiSeq:

N701:
CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

N501:
AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

It didn't detect clusters (I used the provided sequencing primers).

Anyone have any ideas of what went wrong? I'm dumbfounded.

I guess I don't understand your strategy.
Looks to me like clusters should have formed, but I don't see anywhere for the standard sequencing primers to anneal. Which would make the clusters undetectable unless you added custom sequencing primer. If you did add custom sequencing primer, does it have an annealing temp of 65 oC (or higher)? The Illumina document that Tony attached above points out that primers with lower annealing temps might not work.

Eg, your i5 adapter:

AATGATACGGCGACCACCGAGATCTACA | CTAGATCG | CTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Flow cell binding----------- | index??? | ?____________________what is this?


Oh wait, that is the old Nextera transposase sequence. Guess Illumina does not include it in their standard i5 primer cocktail. You would have to spike it in.

--
Phillip

[uberfinch]

Thanks for your reply Philip. Yes, as you surmised those 19 bp on the end are the nextera sequence taken from the sequence reported in Illumina's letter for version 2. To make absolutely sure it was right I TOPO cloned a library made with the Nextera XT kit that is supposedly compatible with the miseq on got that exact adapter sequence.

Is there any reason to believe the PCR primers for nextera are somehow modified?

[pmiguel]

PCR primers? No.
It is the internal segment, closest to the "insert" that has been replaced in the Illumina Nextera kits.
Details in the "Illumina Customer Sequence Letter".
Again, I think you probably did get clusters on your flow cell. They just were invisible because Illumina sequencers only detect clusters to which a read1 sequencing primers can anneal.

--
Phillip

[pmiguel]

Originally Posted by uberfinch

To make absolutely sure it was right I TOPO cloned a library made with the Nextera XT kit that is supposedly compatible with the miseq on got that exact adapter sequence.

Are you sure it was a Nextera XT kit, not an old (possibly Epicentre) Nextera kit that you topo cloned and Sanger sequenced?

--
Phillip

[uberfinch]

Yes, I'm positive it is a Nextera XT kit (just bought it!). If you look on the illumina letter, those sequences are from the Illumina V.2 nextera kits.

Anyway I guess there isn't a good explanation for why it didn't work. Maybe I'll just have to risk burning another kit! There's only so many times you can stare at the sequences looking for an error.

[pmiguel]

Okay, my mistake. Your adapters should be fine.
Is this just a normal NexteraXT kit library, or a set of amplicons you constructed in another manner to mimic the structure of a Nextera library?

We just did a MiSeq run on a NexteraXT library (our first Nextera run). It worked. I even spiked in 30% phiX, just in case. (Denature the normal, NaOH way, diluted to 8pM and mixed 30:70 vol:vol with the heat denatured NexteraXT library.)

Actually, that was our second Nextera run. We ran the same library (no phiX) the previous day on another MiSeq and it terminated prematurely (crashed) without imaging apparently. Maybe I should have mentioned this earlier? But I was pretty sure this was a fluidics issue because the instrument failed a subsequent volume test.

--
Phillip