Convert FASTA to FASTAQ

jomaco · 10-30-2011, 07:09 AM

Hi

I need to map small RNA sequences onto a genome using BWA.

The read file (reads.fa) is in the following format:

>EMUNAOL01D19UY length 23 duplications 0
CGTCTTGGTTTGTCTAAAGGGGC
>EMUNAOL01EK9BY length 24 duplications 0
TGGTGGAGGCCCGCAGCGATACTG
>EMUNAOL02GZHTT length 24 duplications 0
GGGCAAAAGTACAAAGTTCATGTG
>EMUNAOL02IQUC1 length 24 duplications 0
AGAAATGTTGCTACATAAATTGGA

How can I convert this file to a FASTAQ file (reads.fastq) suitable for BWA?

I tried maq but I couldn't get it to work - it just produced a file of 0 bytes - so i'm not sure if it's suitable for what i'm trying to do. Is there another program might be useful?

Thanks

Jon

lh3 · 10-30-2011, 07:17 AM

BWA accepts reads in the fasta format.

jomaco · 10-30-2011, 08:41 AM

Sorry. You're right it does. Someone who asked me to run the alignment told me it was required to convert the read file to fastaq format. Perhaps I should not be so trustful next time!

I have now managed to get the alignment to run. Thanks for your reply

maubp · 10-31-2011, 09:46 AM

What's this "FASTAQ" format? Do you mean "FASTQ"?

lh3 · 10-31-2011, 10:53 AM

I believe "FASTAQ" is a typo, but actually fasta+fastq is really a fastaq format. You can mix fasta and fastq records in one file with no problem. A multi-line fastq parser can be trivially modified to parse such a file. This is basically what my fastq/fasta parser is doing. To most of my recent programs (maq excluded), fasta and fastq are the same format.

maubp · 10-31-2011, 11:00 AM

Mixing FASTA and FASTQ into one file... that strikes me as a strange and dangerous idea, although I can see uses for it (combining raw read datasets of different types into one file for alignment).

lh3 · 10-31-2011, 11:14 AM

I am not saying this is a good format. I am saying that there should really be one parser instead of two.

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
How to convert from sff to fasta or fastq	shuang	Bioinformatics	12	05-15-2014 09:09 AM
Convert fastq from NCBI SRA to fasta and qual?	kmkocot	Bioinformatics	7	10-09-2012 10:15 AM
Bioperl Script to convert fasta to fq	Lizex	Bioinformatics	0	01-26-2012 11:21 PM
MAQ-convert fasta to fastq	rururara	Bioinformatics	0	12-08-2011 12:06 AM
Convert Maq's out put to fasta/fastq?	bea	Bioinformatics	5	06-04-2009 02:18 AM

10-30-2011, 07:09 AM	#1
jomaco Member Location: Sheffield Join Date: Oct 2011 Posts: 26	Convert FASTA to FASTAQ Hi I need to map small RNA sequences onto a genome using BWA. The read file (reads.fa) is in the following format: >EMUNAOL01D19UY length 23 duplications 0 CGTCTTGGTTTGTCTAAAGGGGC >EMUNAOL01EK9BY length 24 duplications 0 TGGTGGAGGCCCGCAGCGATACTG >EMUNAOL02GZHTT length 24 duplications 0 GGGCAAAAGTACAAAGTTCATGTG >EMUNAOL02IQUC1 length 24 duplications 0 AGAAATGTTGCTACATAAATTGGA How can I convert this file to a FASTAQ file (reads.fastq) suitable for BWA? I tried maq but I couldn't get it to work - it just produced a file of 0 bytes - so i'm not sure if it's suitable for what i'm trying to do. Is there another program might be useful? Thanks Jon Last edited by jomaco; 10-30-2011 at 07:15 AM.

10-30-2011, 07:17 AM	#2
lh3 Senior Member Location: Boston Join Date: Feb 2008 Posts: 693	BWA accepts reads in the fasta format.

10-30-2011, 08:41 AM	#3
jomaco Member Location: Sheffield Join Date: Oct 2011 Posts: 26	Sorry. You're right it does. Someone who asked me to run the alignment told me it was required to convert the read file to fastaq format. Perhaps I should not be so trustful next time! I have now managed to get the alignment to run. Thanks for your reply

10-31-2011, 09:46 AM	#4
maubp Peter (Biopython etc) Location: Dundee, Scotland, UK Join Date: Jul 2009 Posts: 1,543	What's this "FASTAQ" format? Do you mean "FASTQ"?

10-31-2011, 10:53 AM	#5
lh3 Senior Member Location: Boston Join Date: Feb 2008 Posts: 693	I believe "FASTAQ" is a typo, but actually fasta+fastq is really a fastaq format. You can mix fasta and fastq records in one file with no problem. A multi-line fastq parser can be trivially modified to parse such a file. This is basically what my fastq/fasta parser is doing. To most of my recent programs (maq excluded), fasta and fastq are the same format.

10-31-2011, 11:00 AM	#6
maubp Peter (Biopython etc) Location: Dundee, Scotland, UK Join Date: Jul 2009 Posts: 1,543	Mixing FASTA and FASTQ into one file... that strikes me as a strange and dangerous idea, although I can see uses for it (combining raw read datasets of different types into one file for alignment).

10-31-2011, 11:14 AM	#7
lh3 Senior Member Location: Boston Join Date: Feb 2008 Posts: 693	I am not saying this is a good format. I am saying that there should really be one parser instead of two.