SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Multiple sequence alignment analysis biobudhan Bioinformatics 1 03-28-2012 08:11 PM
Multiple alignment distances murphycj Bioinformatics 6 03-05-2012 07:04 PM
SNP in multiple sequence alignment spike1985 Bioinformatics 1 02-28-2012 10:52 PM
Multiple alignment why and what for (Bowtie -k options) pmcqt Bioinformatics 0 11-29-2011 06:48 AM
mapping reads to known miRNAs precursors vebaev Bioinformatics 1 08-03-2011 06:48 AM

Reply
 
Thread Tools
Old 03-06-2012, 10:47 AM   #1
polsum
Member
 
Location: Texas

Join Date: May 2009
Posts: 32
Default Multiple Alignment of miRNAs with Precursors

Hi I am looking for a program that can align all miRNA variants or isomirs to the precursers and produce a map like below. Can you please suggest a program for that? thanks in advance.

PHP Code:
>mmu-let-7f-2
total read count                        2702595
mmu
-let-7f-5p read count                2702589
remaining read count                    6
exp                                     fffffff5555555555555555555555fffffffffffffffffffffffffffffff
pri_seq                                 ugugggaugagguaguagauuguauaguuuuagggucauaccccaucuuggagauaacua
pri_struct                              
...((((((.((((...((((.((......)).)))).)))).))))))...........    #MM
a2b_26359701_x1                         ....gUaugagguaguagauuguaua..................................    1
a2b_27273292_x1                         
.....Uaugagguaguagauuguau...................................    1
a2b_24052491_x48                        
.....gUugagguaguagauuguaua..................................    1
a2b_26138224_x2                         
.....Aaugagguaguagauuguauagu................................    1
a2b_27325497_x1                         
.....Uaugagguaguagauuguauagu................................    1
a2b_26941374_x1                         
.....Aaugagguaguagauuguauaguu...............................    
polsum is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:04 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO