SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Reproduce genome coverage of ENCODE-CSHL Long RNA-seq data, but failed? josephyan RNA Sequencing 1 10-31-2012 04:51 PM
Question: Information about the Caltech RNA-Seq data on ENCODE and its corresponding tmy1018 Bioinformatics 1 08-15-2012 01:04 PM
RNA-Seq: easyRNASeq: a bioconductor package for processing RNA-Seq data. Newsbot! Literature Watch 0 08-01-2012 03:00 AM
is is possible to visualize RNA-seq data in UCSC genome browser(ENCODE)? HSV-1 RNA Sequencing 5 07-21-2012 07:24 PM

Reply
 
Thread Tools
Old 05-12-2013, 07:37 AM   #1
dzmtnvmt
Member
 
Location: Shanghai China

Join Date: Apr 2010
Posts: 11
Default How to processing ENCODE small RNA-seq data

Here is a problem when processing CshlShortRnaSeq data from ENCODE.

For example, for 1*36bp Gm12878, I found the adaptor or primer sequence of small RNA library were:
-------------------------------------------------------------------
5’SBS3_Adapter (This is the RNA ligated onto the 5’ end): “r” = ribose, RNA base
5’- rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU
A-Tail RT Primer (This is the primer used in the RT reaction):
5’-TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTTTTTTTTTTTTVN
PE 5’ PCR (PCR Primer):
5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC
PE 3’ PCR (PCR Primer):
5’-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTC
----------------------------------------------------------------------

but I found that there were few reads with the adaptor on the 5' side, but rather, there are many "AGATCGGTTGT*" (the reverse of 5'adaptor) after the ployA in the 3' side. So, I am not sure if it would be correct if I clip the 5'SBS3_adaptor and 3'ploy A, and process those data accuratly using aligners such as Bowtie.

I will be appreciative if anyone could help~
dzmtnvmt is offline   Reply With Quote
Old 05-13-2013, 07:14 PM   #2
alexdobin
Senior Member
 
Location: NY

Join Date: Feb 2009
Posts: 161
Default

At the 3' ends of your reads you should see the reverse complementary to the A-Tail RT Primer sequence: 5’-TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTTTTTTTTTTTTVN
i.e.
AAAAAAAAAAAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGA

We trimmed any sequence that contained AAAAAA (6As). This is a very aggressive trimming - we hoped to get rid of all the genomic A-homopolymer priming sites. STAR can do it for you with:
--clip3pAdapterSeq AAAAAA --clip3pAdapterMMp 0
alexdobin is offline   Reply With Quote
Old 05-13-2013, 09:38 PM   #3
dzmtnvmt
Member
 
Location: Shanghai China

Join Date: Apr 2010
Posts: 11
Default

Quote:
Originally Posted by alexdobin View Post
At the 3' ends of your reads you should see the reverse complementary to the A-Tail RT Primer sequence: 5’-TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTTTTTTTTTTTTVN
i.e.
AAAAAAAAAAAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGA

We trimmed any sequence that contained AAAAAA (6As). This is a very aggressive trimming - we hoped to get rid of all the genomic A-homopolymer priming sites. STAR can do it for you with:
--clip3pAdapterSeq AAAAAA --clip3pAdapterMMp 0

Thanks for your reply. Do you imply that the 5'SBS3_adaptor has already been trimmed in the raw fastq data?
BTY, I found that the 5’SBS3_Adapter and A-tail primer all have "CGCTCTTCCGATCT". Is there any meaning from this?
dzmtnvmt is offline   Reply With Quote
Old 05-14-2013, 05:15 AM   #4
alexdobin
Senior Member
 
Location: NY

Join Date: Feb 2009
Posts: 161
Default

Under normal conditions, the 5' adapter does not get sequenced - the sequencing starts from the 1st base of the RNA sequence. The only sequence you have to worry about is the 3' adapter.
alexdobin is offline   Reply With Quote
Old 05-14-2013, 07:23 AM   #5
dzmtnvmt
Member
 
Location: Shanghai China

Join Date: Apr 2010
Posts: 11
Default

Got that, thank you!
dzmtnvmt is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:57 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO