SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Tophat v1.4.0 (Transcriptome Alignment) Jon_Keats Bioinformatics 6 02-21-2012 06:31 PM
BWA alignment followed by TopHat slny Bioinformatics 9 06-06-2011 07:19 AM
How does Tophat rank alignment? hyj004 Bioinformatics 0 01-19-2011 02:54 PM
tophat total alignment zorph Bioinformatics 4 12-09-2010 05:09 AM
TOPHAT EMPTY accepted_hits.bam ISSUE waterboy Bioinformatics 1 11-16-2010 09:48 AM

Reply
 
Thread Tools
Old 03-16-2010, 11:39 AM   #1
telos
Member
 
Location: London

Join Date: Jan 2010
Posts: 11
Default TopHat alignment issue

Hello,

I have encountered a situation where error-free reads generated from a cDNA fasta file do not align to the correct transcripts. Instead, they align to the junction of a different transcript. Does anyone have any idea why this is? Is it due to a bug?

Below is a series of 23 reads to demonstrate the problem (and below that the SAM output). The IDs of the reads (before the '.' character) correspond to the true transcripts which produced them (the sequences perfectly match the Ensembl v56-annotated reference). If you run TopHat you will find that the reads align to a completely incorrect transcript --- the junction of ENSMUST00000111033 --- and not to the correct transcripts.

I used option -G with a GFF file derived from the Ensembl v56 mouse GTF file.

Many thanks
Ernest.

>ENSMUST00000034431.1
TTGTTTGTTTGTTTGTTGTTGTTTTTGTTTTGTTT
>ENSMUST00000031124.46
TGTTTGTTTGTTTGTTTTTTGTTTTGTTTTGTTTT
>ENSMUST00000116594.499
TGTTTGTTTTTTGTTTTGTTTTGTTTTGTTTTGTT
>ENSMUST00000119430.145
TCTTTGTTTTTGTTTTTGTTTTATTTTGTTTTGTT
>ENSMUST00000090791.46
TTTTTTTTTTTTTGTTTTGTTTTGTTTTGTTTTGT
>ENSMUST00000034136.73
TTTTTGTTTTTGTTTTGTTTTGTTTTGTTCTTTTT
>ENSMUST00000086538.200
TTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTT
>ENSMUST00000002145.103
AAAACAAAACAAAACAAAACAAAACAAAACAAAAA
>ENSMUST00000086909.75
AAAACAAAACAAAACAAAACAAAACAAAACCAACA
>ENSMUST00000115059.42
AAAACAAAACAAAACAAAACAAAACAAAAAAAAAA
>ENSMUST00000002145.140
CAAAACAAAACAAAACAAAACAAAACAAAACAAAA
>ENSMUST00000002145.33
CAAAACAAAACAAAACAAAACAAAACAAAACAAAA
>ENSMUST00000023147.258
CAAAACAAAACAAAACAAAACAAAACAAAACCAAA
>ENSMUST00000086909.105
CAAAACAAAACAAAACAAAACAAAACAAAACCAAC
>ENSMUST00000086909.80
CAAAACAAAACAAAACAAAACAAAACAAAACAAAA
>ENSMUST00000002145.15
ACAAAACAAAACAAAACAAAACAAAACAAAACAAA
>ENSMUST00000002145.124
AACAAAACAAAACAAAACAAAACAAAACAAAACAA
>ENSMUST00000002145.142
AACAAAACAAAACAAAACAAAACAAAACAAAACAA
>ENSMUST00000078755.138
AACAAAACAAAACAAAACAAAACAAAACAAAAAAA
>ENSMUST00000078755.58
AACAAAACAAAACAAAACAAAACAAAAAAACAACA
>ENSMUST00000098666.32
AACAAAACAAAACAAAACAAAACAAAACAAAACAA
>ENSMUST00000098668.78
AACAAAACAAAACAAAACAAAACAAAACAAAACAA
>ENSMUST00000098672.52
AACAAAACAAAACAAAACAAAACAAAACAAAACAA

@HD VN:1.0 SO:sorted
@PG TopHat VN:1.0.13 CL:/home/et04/bin/tophat -G /work/et04/GFFfiles/Mus_musculus.NCBIM37.56.adapted.gff -o littletest3.results -p 8 mm9 /work/et04/RNAseqData/simulatedmouse/littletest.fasta
ENSMUST00000034431.1 0 chr2 109766876 255 23M179N12M * 0 0 TTGTTTGTTTGTTTGTTGTTGTTTTTGTTTTGTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NS:i:1
ENSMUST00000031124.46 0 chr2 109766877 255 22M179N13M * 0 0 TGTTTGTTTGTTTGTTTTTTGTTTTGTTTTGTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000116594.499 0 chr2 109766885 255 14M179N21M * 0 0 TGTTTGTTTTTTGTTTTGTTTTGTTTTGTTTTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000119430.145 0 chr2 109766885 255 14M179N21M * 0 0 TCTTTGTTTTTGTTTTTGTTTTATTTTGTTTTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000090791.46 0 chr2 109766889 255 10M179N25M * 0 0 TTTTTTTTTTTTTGTTTTGTTTTGTTTTGTTTTGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000034136.73 0 chr2 109766891 255 8M179N27M * 0 0 TTTTTGTTTTTGTTTTGTTTTGTTTTGTTCTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000086538.200 0 chr2 109766891 255 8M179N27M * 0 0 TTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000002145.103 16 chr2 109766892 255 7M179N28M * 0 0 TTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000086909.75 16 chr2 109766892 255 7M179N28M * 0 0 TGTTGGTTTTGTTTTGTTTTGTTTTGTTTTGTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000115059.42 16 chr2 109766892 255 7M179N28M * 0 0 TTTTTTTTTTGTTTTGTTTTGTTTTGTTTTGTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NS:i:1
ENSMUST00000002145.140 16 chr2 109766893 255 6M179N29M * 0 0 TTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000002145.33 16 chr2 109766893 255 6M179N29M * 0 0 TTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000023147.258 16 chr2 109766893 255 6M179N29M * 0 0 TTTGGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NS:i:1
ENSMUST00000086909.105 16 chr2 109766893 255 6M179N29M * 0 0 GTTGGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000086909.80 16 chr2 109766893 255 6M179N29M * 0 0 TTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000002145.15 16 chr2 109766894 255 5M179N30M * 0 0 TTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000002145.124 16 chr2 109766895 255 4M179N31M * 0 0 TTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000002145.142 16 chr2 109766895 255 4M179N31M * 0 0 TTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000078755.138 16 chr2 109766895 255 4M179N31M * 0 0 TTTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:1 XS:A:+ NS:i:1
ENSMUST00000078755.58 16 chr2 109766895 255 4M179N31M * 0 0 TGTTGTTTTTTTGTTTTGTTTTGTTTTGTTTTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000098666.32 16 chr2 109766895 255 4M179N31M * 0 0 TTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000098668.78 16 chr2 109766895 255 4M179N31M * 0 0 TTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
ENSMUST00000098672.52 16 chr2 109766895 255 4M179N31M * 0 0 TTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 XS:A:+ NS:i:2
telos is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:34 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO