SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
primer design razibus General 6 12-05-2014 06:04 AM
design tetra-primer ARMS PCR lehang Bioinformatics 0 04-17-2014 12:46 AM
PCR primer -- a PCR simulation on your computer gringer General 0 01-26-2012 03:03 AM
PCR Primer Design Software for Gap-closure bulletin2007 454 Pyrosequencing 5 05-19-2010 12:58 PM

Reply
 
Thread Tools
Old 12-01-2014, 07:40 AM   #1
ksil91
Junior Member
 
Location: Chicago, IL

Join Date: Nov 2014
Posts: 2
Default Indexed PCR Primer Design

Hello, I'm new here so apologies if this question has been answered.

I'm following the Buckler Lab GBS protocol and only have access to 48 adapters for ApeKI. I'd like to multiplex these into one Illumina lane using indexed PCR primers. I found sequences for PCR primers from the ddRAD protocol(Peterson). Do I have to alter the sequence at all to match my ApeKI adapters? Do I have to request anything particular when ordering these primers from IDT? Or would it be better for me to just order the NEBNext Multiplex Oligos for Illumina Kit? (https://www.neb.com/products/e7335-n...-primers-set-1)

ApeKI Common Adapter:
5'-CWGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
5'-CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

ApeKI Barcoded Adapter:
5-CWGxxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
5-ACACTCTTTCCCTACACGACGCTCTTCCGATCTyyyy

PCR primers I'm considering ordering:
PCR1: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG
PCR2_Idx_1_ATCACG: CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGC
PCR2_Idx_2_CGATGT: CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGC
PCR2_Idx_3_TTAGGC: CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGC
PCR2_Idx_4_TGACCA: CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGC
ksil91 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:31 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO