
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
Assertion failed error in BFAST localalign seeker Bioinformatics 7 09-02-2011 10:33 PM
Bfast localalign error dg.pooja General 1 01-31-2011 06:35 PM
bfast localalign issues yy01 Bioinformatics 8 12-15-2010 12:19 AM
bfast localalign -U option? Protaeus Bioinformatics 2 09-17-2010 12:50 PM
BFAST match/localalign help Esther Bioinformatics 3 08-04-2010 06:19 AM

Thread Tools
Old 01-03-2011, 12:29 PM   #1
Location: Bethesda

Join Date: Jul 2010
Posts: 15
Default bfast localalign error


I am trying to map exome data using bfast. I received *.sam files from our collaborates. Here's a summary of my method:

1. Converted *.sam to *.fastq using PICARD
2. Converted hg19.fa to color space - hg19.fa.cs.brg
3. Created index for reference - hg19.fa.cs.1.1.bif
4. Search indexes successful - *.bmf
5. Perform local alignment - gave me an error! Thanks to Seqanswers forums, I realized that I have to convert reference to nucleotide space as well. So, now I have hg19.fa.nt.brg
6. Tried to run local alignment again.....but got "AlignColorSpaceGappedConstrained" error!!!

Checking input parameters supplied by the user ...
Validating fastaFileName chr_all.fa.
Validating matchFileName03C14605A_bfastMatches_hg19.bmf.
**** Input arguments look good! *****
Printing Program Parameters:
programMode: [ExecuteProgram]
fastaFileName: chr_all.fa
matchFileName: 03C14605A_bfastMatches_hg19.bmf
scoringMatrixFileName: [Not Using]
ungapped: [Not Using]
unconstrained: [Not Using]
space: [Color Space]
startReadNum: 1
endReadNum: 2147483647
offsetLength: 20
maxNumMatches: 384
avgMismatchQuality: 10
numThreads: 1
queueLength: 10000
timing: [Not Using]
Reading in reference genome from chr_all.fa.nt.brg.
In total read 25 contigs for a total of 3095693983 bases
Reading match file from 03C14605A_bfastMatches_hg19.bmf.
Performing alignment...
Reads processed: 0************************************************************
In function "AlignColorSpaceGappedConstrained": Fatal Error[OutOfRange]. Message: read and reference did not match.
***** Exiting due to errors *****

Thank you in advance for your help.

nimmi is offline   Reply With Quote
Old 01-04-2011, 03:30 AM   #2
Senior Member
Location: 4117'49"N / 24'42"E

Join Date: Oct 2008
Posts: 323

Can you show the files from within the reference directory as well as the exact commands you run?

Is it possible you forgot to use -A1 to tell bfast to compute the local alignments in CS?
drio is offline   Reply With Quote
Old 01-04-2011, 12:00 PM   #3
Location: Bethesda

Join Date: Jul 2010
Posts: 15

Here are the list of files in my directory:


Here's the command I used for local alignment:

$/usr/local/bfast/bin/bfast localalign -f chr_all.fa -m 03C14605A_bfastMatches_hg19.bmf -A 1
> 03C14605A_bfastMatches_hg19_localalign.baf

Thank you very much
nimmi is offline   Reply With Quote
Old 01-04-2011, 02:23 PM   #4
Nils Homer
nilshomer's Avatar
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285

Looks like the fastq is not in the proper format. You need to extract the color sequence and color qualities from the SAM file in the CS/CQ optional tags.
nilshomer is offline   Reply With Quote
Old 01-04-2011, 02:44 PM   #5
Location: Bethesda

Join Date: Jul 2010
Posts: 15

Thanks Nils for your response. Here's a few lines from my *.sam file:

BABBBB@ABB=BAAB@<BBB;@=BB?;A@B><7=7B>;>@9B@<97+B84 NH:i:508 CS:Z:T22301002301002301002301002301002301002301002301002
1649_965_405_F3 16 chr1 10014 0 50M * 0 0 AACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA +9==%'4587'1+:7@28957<5=7;6@2:=BAB:<?@AB<B<AA?BB@@ NH:i:511 CS:Z:T00320010320010320010320010320010320010320010300010
1433_953_927_F3 16 chr1 10026 0 50M * 0 0 AACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA '%:7+(6-;>%:4(<<8:=-:@268%>>644)::7>9;>B@@2?@A@B?A NH:i:511 CS:Z:T00320010320010320010320010320010320010320010320010
<96BA6>7<?>/;6<?1482:41-)+1+466-+4752/6/8!;11/-)>1 NH:i:517 CS:Z:T20230100230100230100230100230100230100230100230100
:%6=%!-2+7!%==<)!:1:4+)--8B6914:>1:/46:+;=:=@<</'> NH:i:517 CS:Z:T10010320010320010320010320010320010320010320010320
?>B>@@:AB9>=?><@6B?8<><B;<;;<B</<?4@:5929B56/2)@@) NH:i:508 CS:Z:T22301002301002301002301002301002301002301002301002
nimmi is offline   Reply With Quote
Old 01-04-2011, 03:03 PM   #6
Nils Homer
nilshomer's Avatar
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285

If you have fragment reads, then the following perl code should do it. Pipe the SAM file into it (or use "samtools view <in.bam>" for a BAM file). For paired end or multi-end reads, it does get trickier and the below will not keep the pairings. Note that your input SAM file does not have the CQ tag, and thus color qualities are lost.

use strict;
use warnings;
while(defined(my $line = <STDIN>)) {
    if($line =~ m/^@/) {
    my $NAME = $line;
    my $CS = $line;
    my $CQ = "";
    $NAME =~ s/^([^\t]+)\t.*/$1/;
    $CS =~ s/.*CS:Z:([^\t]+).*/$1/;
    $CS =~ tr/ /4/;
    if($line =~ m/CQ:Z:([^\t]+)/) {
        $CQ = $1;
    else {
        $CQ = "!" x (length($CS)-1); 
    print STDOUT "\@$NAME\n$CS\n+\n$CQ\n";
nilshomer is offline   Reply With Quote
Old 01-05-2011, 09:40 AM   #7
Location: Bethesda

Join Date: Jul 2010
Posts: 15

Thanks Nils for the perl script.

Just to summarize........I converted *.sam file to *.fastq using PICARD and this fastq file was in nucleotide space. When I ran localalign in bfast I got the "AlignColorSpaceGappedConstrained" error. Then I used perl script posted by Nils to convert *.sam to *.fastq in colorspace. Then re-ran the match command (*.bmf) followed by localalign and everything works fine!

Thank you all for your suggestions and responses
nimmi is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 06:11 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO