SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Trimmomatic quality trimming kga1978 Bioinformatics 26 11-24-2015 11:14 AM
Trimmomatic but no trimming Saeideh Bioinformatics 6 09-29-2015 12:40 AM
Kmers remain even after trimmomatic trimming modi2020 Bioinformatics 17 03-16-2015 05:47 AM
Adapters trimming: Cutadapt vs Trimmomatic MafaldaSF Bioinformatics 8 03-20-2014 07:16 AM
Trimming Illumina PE sequences with Trimmomatic nicole_01 Bioinformatics 5 08-28-2013 06:12 PM

Reply
 
Thread Tools
Old 11-11-2017, 12:39 PM   #1
lchippy
Junior Member
 
Location: San Diego

Join Date: Nov 2017
Posts: 3
Default Trimmomatic: Not trimming..

Hey! I am trying to use Trimmomatic to trim Illumina adapters sequences from my TruSeq Small RNA library SE 75bp reads off of a HiSeq but I am unsuccessful... I'm fairly novice so I am probably making a novice mistake and would appreciate any help!

Here is the script I am trying to run:

java -jar ~/applications/Trimmomatic-0.36/trimmomatic-0.36.jar SE -threads 4 -phred33 -trimlog ~/path/sample1_trimlog ~/pathtoinput/sample1.fastq ~/pathtooutput/sample1_trim.fastq ILLUMINACLIP:~/applications/Trimmomatic-0.36/adapters/smRNA_TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:10

The smRNA_TruSes3-SE.fa:
>TruSeq3_IndexedAdapter
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>TruSeq3_UniversalAdapter
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
>RPI2
CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RPI9
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG
>RPI10
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG
>RPI11
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG
>RPI4
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG
>RPI5
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG
>RPI6
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG
>RPI7
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG

Thanks for any help!

Last edited by lchippy; 11-12-2017 at 11:34 AM.
lchippy is offline   Reply With Quote
Old 11-12-2017, 08:25 AM   #2
mastal
Senior Member
 
Location: uk

Join Date: Mar 2009
Posts: 662
Default

You have 'PE' in your command, but you appear to be trying to trim SE data, because you are providing the names of one input file and one output file only, so you should change that to 'SE'.
mastal is offline   Reply With Quote
Old 11-12-2017, 10:17 AM   #3
lchippy
Junior Member
 
Location: San Diego

Join Date: Nov 2017
Posts: 3
Default

Oh shoot, that was troubleshooting. I was running this command with the SE designation but since I was having problems I started marching along the command and changing each part just to see if that helps. (Ie/ iíve Done it with SE and it hasnít worked)

Does my ILUMINACLIP part look correct?
lchippy is offline   Reply With Quote
Old 11-12-2017, 03:51 PM   #4
mastal
Senior Member
 
Location: uk

Join Date: Mar 2009
Posts: 662
Default

Your command looks OK, why do you think it's not working?

Is trimmomatic running, and what output do you get when it finishes?
mastal is offline   Reply With Quote
Old 11-12-2017, 07:32 PM   #5
lchippy
Junior Member
 
Location: San Diego

Join Date: Nov 2017
Posts: 3
Default

Trimmomatic runs and seems to do everything except trim Illumina adapter sequences. Ie/ It runs normals, trim low quality bases, doesn't fail, and takes what seems to be a appropriate about of time. It also outputs a "trimmed" file though the illumina adapters are still there... At first I thought it was my adapter files, so on top of using a file I created, I also downloaded one I found online. (https://github.com/Transipedia/dekup...er/adapters.fa)

So not sure whats wrong but happy for any troubleshooting tips!
lchippy is offline   Reply With Quote
Old 11-13-2017, 02:39 AM   #6
mastal
Senior Member
 
Location: uk

Join Date: Mar 2009
Posts: 662
Default

Have you tried running trimmomatic with only the ILLUMINACLIP command and not the rest of the quality trimming, just to see how the Illuminaclip part works?

Are you sure you are using the right adapter sequences/barcodes that were used with your samples?
mastal is offline   Reply With Quote
Old 11-13-2017, 05:38 AM   #7
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,135
Default

Quote:
Originally Posted by lchippy View Post
Hey! I am trying to use Trimmomatic to trim Illumina adapters sequences from my TruSeq Small RNA library SE 75bp reads off of a HiSeq but I am unsuccessful... I'm fairly novice so I am probably making a novice mistake and would appreciate any help!

Here is the script I am trying to run:

java -jar ~/applications/Trimmomatic-0.36/trimmomatic-0.36.jar SE -threads 4 -phred33 -trimlog ~/path/sample1_trimlog ~/pathtoinput/sample1.fastq ~/pathtooutput/sample1_trim.fastq ILLUMINACLIP:~/applications/Trimmomatic-0.36/adapters/smRNA_TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:10

The smRNA_TruSes3-SE.fa:
>TruSeq3_IndexedAdapter
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>TruSeq3_UniversalAdapter
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
>RPI2
CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
>RPI9
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG
>RPI10
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG
>RPI11
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG
>RPI4
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG
>RPI5
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG
>RPI6
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG
>RPI7
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG

Thanks for any help!
You have the wrong sequences in your adapter file. The TruSeq Small RNA adapter sequences differ from the standard TruSeq RNA/DNA adapters. Also, you do not need the individual index sequences, just the common portions of the Index and Universal adapters are needed. Here is the TruSeq Small RNA file I use with Trimmomatic:

Code:
>TruSeq3_smRNA_IndexAdapter
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC
>TruSeq3_smRNA_Universal
GATCGTCGGACTGTAGAACTCTGAACGTGTAGA
kmcarr is offline   Reply With Quote
Reply

Tags
adapter trimming, adapters, hiseq, illumina, trimmomatic

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:22 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO