GSNAP: align_score higher than set in -m

[stefan_bioinf]

Hi All,

I'd like to clarify something which I find odd on my GSNAP output.

I ran GSNAP (version 2015-09-29) like this (i.e. maximally 2 mismatches):

gsnap -d mm9 -s /usr/local/share/mm9/mm9.maps/mm9.iit -m 2 -i 1 -n 1 --quiet-if-excessive poly_coll.fasta > results

and my output contains hits like this one:

>ATGTCACTCCAATGAAAGCCTTGG	1	100-1
 gtgtgcttgCAATGAAAGCCTTGG	10..24	-chr10:125750727..125750713	start:9..end:0,matches:19,sub:0	segs:1,align_score:5,mapq:40,method:sa

I concluded that maybe due to the trimming the mismatches at the beginning don't count (sub:0), although it clearly stands: align_score:5. Therefore, I switched trimming off using --trim-mismatch-score and --trim-indel-score flags:

gsnap -d mm9 -s /usr/local/share/mm9/mm9.maps/mm9.iit -m 2 -i 1 -n 1 --quiet-if-excessive --trim-mismatch-score=0 --trim-indel-score=0 poly_coll.fasta > results

An I still get:

>ATGTCACTCCAATGAAAGCCTTGG	1	100-1
 gTGTgctTgCAATGAAAGCCTTGG	1..24	-chr10:125750736..125750713	start:0..end:0,matches:19,sub:5	segs:1,align_score:5,mapq:40,method:sa

sub increased to 5 and align_score stays 5. Why have I got this hit in my results?

What's more, I get:

>GGAGGAAAAAGTCACAGAAGAAGTGGCTG	1	101-1
 aggcagacAAGTCACAGAAGAAGTGGtgG	9..29	-chr2:36642591..36642571	start:8..end:0,matches:19,sub:2	segs:1,align_score:2,mapq:40

which got trimmed, even though I turned trimming off.

I guess I'm missing something, please help.

Thanks in advance
Stefan