SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Strange maq 7.1 problem homeriq5 Bioinformatics 7 11-26-2013 07:19 AM
problem with running MAQ seq_lover Bioinformatics 0 10-30-2011 09:31 PM
Problem installing MAQ sam253 Bioinformatics 0 03-25-2010 01:38 AM
Maq problem: 0 raw reads mapped pparg Bioinformatics 8 11-17-2009 12:16 AM
Maq reads split problem cliff Bioinformatics 1 11-07-2009 03:29 PM

Reply
 
Thread Tools
Old 11-11-2009, 08:54 AM   #1
xiang
Member
 
Location: oxford

Join Date: Mar 2009
Posts: 13
Default maq problem for 108bp reads.

I just started to use maq to map the paired-end reads of 108bp.
When I use command "maq map -e 200 -a 500 a1.bfq a2.bfq",
I always got this:

-- maq-0.7.1
[ma_load_reads] loading reads...
[ma_load_reads] set length of the first read as 108.
[ma_load_reads] set length of the second read as 108.
[ma_load_reads] 1456472*2 reads loaded.
[ma_longread2read] encoding reads... 2912944 sequences processed.
[ma_match] set the minimum insert size as 109.
[match_core] Total length of the reference: 1586004629
[match_core] round 1/3...
[match_core] making index...
[match_index_sorted] no reasonable reads are available. Exit!

I checked the data using "maq bfq2fastq a1.bfq". It shows the data is as this:

@IL41_3804:3:10:236:221/1
CAGTGATTTCGTCATTTTTCAAGTCGTTAAGTGGATATTCCTCATTTTCCATGATTTTCAGTTTTCTTGCCATATTCCATGTCCCACAGTGGACATTTCTAAATTTTC
+
CCDCDBACBABE<CCDDDCCACA;=DCCCBCACCBCCCA?BB=BCCCB@CACA<CCCC?@B@@CC?CB@<=@@0-3<6=A@@>77;5978A?<;=@?@=A?;:=8;??

I can't find any problem. Anyone has idea about this? Thanks.
xiang is offline   Reply With Quote
Old 11-17-2009, 12:42 AM   #2
suseq
Junior Member
 
Location: norway

Join Date: Sep 2009
Posts: 3
Default

I got the same problem with 75 bp long paired end reads. Do you find a resolution?
suseq is offline   Reply With Quote
Old 11-17-2009, 01:02 AM   #3
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

Quote:
Originally Posted by xiang View Post
I just started to use maq to map the paired-end reads of 108bp.
When I use command "maq map -e 200 -a 500 a1.bfq a2.bfq",
I always got this:

-- maq-0.7.1
[ma_load_reads] loading reads...
[ma_load_reads] set length of the first read as 108.
[ma_load_reads] set length of the second read as 108.
[ma_load_reads] 1456472*2 reads loaded.
[ma_longread2read] encoding reads... 2912944 sequences processed.
[ma_match] set the minimum insert size as 109.
[match_core] Total length of the reference: 1586004629
[match_core] round 1/3...
[match_core] making index...
[match_index_sorted] no reasonable reads are available. Exit!

I checked the data using "maq bfq2fastq a1.bfq". It shows the data is as this:

@IL41_3804:3:10:236:221/1
CAGTGATTTCGTCATTTTTCAAGTCGTTAAGTGGATATTCCTCATTTTCCATGATTTTCAGTTTTCTTGCCATATTCCATGTCCCACAGTGGACATTTCTAAATTTTC
+
CCDCDBACBABE<CCDDDCCACA;=DCCCBCACCBCCCA?BB=BCCCB@CACA<CCCC?@B@@CC?CB@<=@@0-3<6=A@@>77;5978A?<;=@?@=A?;:=8;??

I can't find any problem. Anyone has idea about this? Thanks.
There is a maximum read length. You'll have to dig in the source code. Try BWA, the successor to MAQ.
nilshomer is offline   Reply With Quote
Old 11-17-2009, 02:12 AM   #4
Jonathan
Member
 
Location: Germany

Join Date: Jun 2009
Posts: 36
Default

Quote:
Originally Posted by suseq View Post
I got the same problem with 75 bp long paired end reads. Do you find a resolution?
Ah, but MAQ works for 76bp PE - at least the latest version did for my dataset.
best
-Jonathan
Jonathan is offline   Reply With Quote
Old 11-17-2009, 05:13 AM   #5
xiang
Member
 
Location: oxford

Join Date: Mar 2009
Posts: 13
Default

I have tried more data. Now I am sure that maq can work for 108bp reads since I have already got some successful cases.

But for some data, It just reports this error. I don't know why.
xiang is offline   Reply With Quote
Old 11-17-2009, 06:21 AM   #6
suseq
Junior Member
 
Location: norway

Join Date: Sep 2009
Posts: 3
Default

The newest version is MAQ 0.7.1, or not? I tried to use this version but get always:
"[match_index_sorted] no reasonable reads are available. Exit! "
The rest looks similar to Xiang`s example: the reads were loaded, the reference as well, but than it stopps.

Do you have any idea why???
suseq is offline   Reply With Quote
Old 02-01-2010, 07:28 AM   #7
stephlg
Junior Member
 
Location: Strasbourg

Join Date: Nov 2008
Posts: 2
Default some news?

In my lab, we sequenced 4 samples on a PE 2x60.All samples have been sequenced on the same flowcell and sequences have been generated with the same pipeline.

I used maq and I managed to align only 2 out of 4 samples. For the two non aligned samples I got the same error as you had.
I tried different parameters but I always have the same error.

I really don't understand why I couldn't align 2 samples since all samples have been processed the same way! They are in the same iFastq format.

Some news about this issue?

Last edited by stephlg; 02-01-2010 at 07:32 AM.
stephlg is offline   Reply With Quote
Old 02-01-2010, 11:35 AM   #8
lh3
Senior Member
 
Location: Boston

Join Date: Feb 2008
Posts: 693
Default

This is most likely that your reads have too many 'N's.
lh3 is offline   Reply With Quote
Old 02-03-2010, 03:40 AM   #9
xiang
Member
 
Location: oxford

Join Date: Mar 2009
Posts: 13
Default

Basically, this part of data is of low quality.

What I have done for them is: chopping them down to a smaller read-length.
for example 108bp -> 93bp and then align it. You can use maq -1 93 to do this without changing the .bfq files.
xiang is offline   Reply With Quote
Old 02-03-2010, 04:34 AM   #10
stephlg
Junior Member
 
Location: Strasbourg

Join Date: Nov 2008
Posts: 2
Default

Actually I had a look on my data and it appeared that a lot of sequences contained a lot of Ns. So I filtered out tags with Ns and aligned them. Finally it has worked.

Thank you for your help
stephlg is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:53 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO