SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Nextera Miseq custom primers adziulko Illumina/Solexa 1 05-19-2017 08:31 PM
Custom primers and PhiX on MiSeq gleb Illumina/Solexa 14 05-09-2017 08:53 AM
Has the NextSeq forgotten how to use custom primers? jwfoley Illumina/Solexa 2 04-08-2015 10:35 PM
miseq custom primers barturas Illumina/Solexa 1 07-01-2013 05:46 AM

Reply
 
Thread Tools
Old 07-21-2017, 01:20 AM   #1
rudzik79
Member
 
Location: Poland

Join Date: May 2016
Posts: 10
Question Custom primers for NextSeq: will they work on MiSeq and HiSeq?

I am wondering whether my experiment (which was originally designed to work on a NextSeq) will work on MiSeq and HiSeq.

It is a library prepared with MIP technique and the PCR primers are

CAAGCAGAAGACGGCATACGAGATNNNNNNNNACACGCACGATCCGACGGTAGTGT
AATGATACGGCGACCACCGAGATCTACACATACGAGATCCGTAATCGGGAAGCTGAAG

My sequencing primers:

FOR CATACGAGATCCGTAATCGGGAAGCTGAAG C
REV ACACGCACGATCCGACGGTAGTGT A
INDX ACACTACCGTCGGATCGTGCGTGT A

I would be grateful for a quick response

Anna
rudzik79 is offline   Reply With Quote
Old 07-21-2017, 07:00 PM   #2
SNPsaurus
Registered Vendor
 
Location: Eugene, OR

Join Date: May 2013
Posts: 416
Default

We use custom primers and run libraries on NextSeq and HiSeq. MiSeq has a higher temperature for binding so a given primer may not work on MiSeq.
__________________
Providing nextRAD genotyping services. http://snpsaurus.com
SNPsaurus is offline   Reply With Quote
Old 07-23-2017, 05:46 AM   #3
rudzik79
Member
 
Location: Poland

Join Date: May 2016
Posts: 10
Lightbulb

Thanks for your reply!
OK, now, how do I check that? What are the boundaries for Tm for MiSeq, NextSeq and HiSeq?
rudzik79 is offline   Reply With Quote
Reply

Tags
custom primers, hiseq, miseq, nextseq

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:06 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO