SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
trim adapter from Illumina Genome Analyzer IIe miRNA reads NicoBxl Bioinformatics 5 01-02-2014 06:31 AM
Illumina Adapter and Primer preparation S.Iyengar Sample Prep / Library Generation 7 11-04-2013 08:08 AM
primer/adapter sequences nikiwilson Sample Prep / Library Generation 2 06-21-2011 02:36 PM
what's the different between Illumina Genome Analyzer biocc Illumina/Solexa 3 06-04-2010 12:28 AM
A clarification for Illumina/Solexa Genome Analyzer Primer/Adapter Sequences kaichen Illumina/Solexa 1 08-06-2009 06:57 PM

Reply
 
Thread Tools
Old 03-11-2009, 07:12 AM   #21
hilahg
Junior Member
 
Location: asia

Join Date: Mar 2009
Posts: 4
Default which adapters to use

Hi all,
I have a question:
I've prepared a cDNA library for solexa (double stranded) with 5' end after enzymatic cleavage by MMEI (see below). I would like to perform a single read from 5' (the left side with the MME sticky end). GEX2 adapter fits this site. My question is which adapter do I need for the 3' side to perform a single read of the 5' side (left side)?

5'_________? 3'
adapter Gex 2 3'___________
(MMEI side) which adapter on this side?

Can anyone answer this???
hilahg is offline   Reply With Quote
Old 03-11-2009, 07:13 AM   #22
hilahg
Junior Member
 
Location: asia

Join Date: Mar 2009
Posts: 4
Default

the figure came out wrong... I hope you can still understand my question above....
hilahg is offline   Reply With Quote
Old 03-11-2009, 03:44 PM   #23
sci_guy
Member
 
Location: Sydney, Australia

Join Date: Jan 2008
Posts: 83
Default

Do pages 17 - 20 of this help?
sci_guy is offline   Reply With Quote
Old 03-12-2009, 02:06 PM   #24
hilahg
Junior Member
 
Location: asia

Join Date: Mar 2009
Posts: 4
Default

yes it helps, thank you
hilahg is offline   Reply With Quote
Old 03-31-2009, 10:55 AM   #25
greigite
Senior Member
 
Location: Cambridge, MA

Join Date: Mar 2009
Posts: 141
Default

Perhaps the sequences are shown in Figure 2 and table S3 of this paper by Craig et al (http://www.nature.com/nmeth/journal/...th.1251.html)? I notice one of the authors has an Illumina affiliation and the paper describes 6 bp error corrected tags. Of course, they don't tell you outright which ones are the best but my guess is the 13 tags showing less than 2-fold difference in index frequencies between runs (Fig 2).

Quote:
Originally Posted by breakt1000 View Post
Hi,

Has anyone got the multiplex oligo sequences that Illumina use in their Multiplex (12-plex) kits? (And their concentrations if they're known.)
greigite is offline   Reply With Quote
Old 04-06-2009, 02:15 PM   #26
greigite
Senior Member
 
Location: Cambridge, MA

Join Date: Mar 2009
Posts: 141
Default comparison of SE and PE sequences

Hi all
I put together a comparison of SR and PE sequences to get a quick look at regions of sequence similarity. Thought it might be useful for others (let me know if you spot errors). As far as I can tell, the SR and PE read 1 sequencing primers are identical, as are the SR and PE adapters with the T overhang. Seems to me that given this, it should be fine to run a PE library on an SR flowcell using SR reagents. Comments?
All the sequences are from the Bentley et al. nature paper supplementary info last year.
Attached Files
File Type: pdf Untitled2.pdf (23.5 KB, 1944 views)
greigite is offline   Reply With Quote
Old 05-31-2009, 01:31 AM   #27
wangdaowen
Junior Member
 
Location: china

Join Date: May 2009
Posts: 2
Smile thank

yes it help,thank
wangdaowen is offline   Reply With Quote
Old 05-31-2009, 01:32 AM   #28
wangdaowen
Junior Member
 
Location: china

Join Date: May 2009
Posts: 2
Default

thank,
Has anyone got the multiplex oligo sequences that Illumina use in their Multiplex (12-plex) kits? (And their concentrations if they're known.)
wangdaowen is offline   Reply With Quote
Old 06-23-2009, 10:51 AM   #29
kwatkins
Junior Member
 
Location: Providence, RI

Join Date: Jun 2009
Posts: 1
Default

Hi!
I am trying to add adapters onto a cDNA pool by PCR. Has anyone done this before? I not sure how to design and orient my primers. I am currently looking to use the adapters for "Genomic DNA oligonucleotide sequences"
Thanks!
Kate
kwatkins is offline   Reply With Quote
Old 07-22-2009, 05:39 PM   #30
jrelmore
Junior Member
 
Location: Athens, GA

Join Date: Jul 2009
Posts: 2
Default

Does anyone happen to know the concentrations of the PR 5' adapter and the 10x v1.5 sRNA 3' adapter in the small RNA cloning kits?
jrelmore is offline   Reply With Quote
Old 07-23-2009, 06:58 PM   #31
jrelmore
Junior Member
 
Location: Athens, GA

Join Date: Jul 2009
Posts: 2
Default

I know a few people other than myself were looking for the concentrations of the Solexa v1.5 kit (and well all of them in my case) adapters. I spoke with a tech support person from Illumina and they told me the concentrations of the stock solutions before any of the dilutions were as such:

3' sRNA Adapter v1.5 = 5M
SRA 5' Adapter = 5M

Other oligos:

SRA RT primer = 100M
Primer GX1/2 = 25M

Hope that helps!

-Joshua
jrelmore is offline   Reply With Quote
Old 08-19-2009, 01:30 AM   #32
frozenlyse
Senior Member
 
Location: Australia

Join Date: Sep 2008
Posts: 136
Default

Hi - I am a bit confused about the Illumina Paired end adaptors..

Are they a Y adaptor (illustrated below) where you have 2 primers which are complementary at the end you ligate to your library (ie i should only synthesise 2 oligos)

Code:
5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
                      |||||||||||||
3'-GAGCCGTAAGGACGACTTGGCGAGAAGGCTAG-PO4-3'
or are they two sets of fully complementary primers, so i should order 4 oligos? this is what it seems to illustrate in post #7

Code:
5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
   ||||||||||||||||||||||||||||||||
3'-TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAG-PO4-5'
and
5'-PO4-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG-3'
       ||||||||||||||||||||||||||||||||
   3'-TCTAGCCTTCTCGCCAAGTCGTCCTTACGGCTC-5'
Cheers!
frozenlyse is offline   Reply With Quote
Old 08-19-2009, 03:54 AM   #33
hilahg
Junior Member
 
Location: asia

Join Date: Mar 2009
Posts: 4
Default

Hi all,
thank you for all the replies. It was very helpful.
I have another question regarding MME cleavage. I use this protocol for library preparation(with MMEI cleavage): http://keck.med.yale.edu/microarrays...04241_RevA.pdf

I'm experiencing trouble with the MME cutting procedure as it doesnt! cleave. Has anyone experienced this problem in the library preparation process. I use MME from NEB
and tried various concentrations but without improvement...

Thanks,

Hilah
hilahg is offline   Reply With Quote
Old 08-19-2009, 06:49 AM   #34
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,135
Default

frozenlyse,

You would only synthesize the two oligos as in your first figure. Look at this thread http://seqanswers.com/forums/showthread.php?t=1169 (in particular the PDF attachment)
kmcarr is offline   Reply With Quote
Old 08-21-2009, 05:42 PM   #35
der_eiskern
Member
 
Location: California

Join Date: Jul 2009
Posts: 46
Default Genomic PCR Oligo Mix

so it's friday evening, and i was supposed to be amplifying my library before going home tonight however my coworker used all of our amplifying PCR Primers 2.1 and 1.1 for SE sequencing and I can't find an accurately labeled figure of the sequences for these SE PCR primers that Illumina sends out. I'm finding PE sequences everywhere though.

clarification?

Thanks.

Quote:
Originally Posted by ECO View Post

Sequences for Solexa Library Preparations:

Genomic DNA oligonucleotide sequences

Adapters 1
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

PCR Primers 1
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT

Genomic DNA Sequencing Primer
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT


DpnII gene expression oligonucleotide sequences

Gex Adapter 1
5' P-GATCGTCGGACTGTAGAACTCTGAAC
5 ACAGGTTCAGAGTTCTACAGTCCGAC

Gex Adapter 2
5' CAAGCAGAAGACGGCATACGANN
5' P-TCGTATGCCGTCTTCTGCTTG

Gex PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Gex PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Gex Sequencing Primer
5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

NlaIII gene expression oligonucleotide sequences

Gex Adapter 1
5' P-TCGGACTGTAGAACTCTGAAC
5' ACAGGTTCAGAGTTCTACAGTCCGACATG

Gex Adapter 2
5' CAAGCAGAAGACGGCATACGANN
5' P-TCGTATGCCGTCTTCTGCTTG

Gex PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Gex PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Gex Sequencing Primer
5' CCGACAGGTTCAGAGTTCTACAGTCCGACATG


Small RNA oligonucleotide sequences

RT Primer
5' CAAGCAGAAGACGGCATACGA

5' RNA Adapter
5' GUUCAGAGUUCUACAGUCCGACGAUC

3' RNA Adapter
5' P-UCGUAUGCCGUCUUCUGCUUGUidT

Small RNA PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Small RNA PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Small RNA Sequencing Primer
5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

**disclaimer blah blah blah. We take no responsibility if you blow a flow cell using these sequences!
der_eiskern is offline   Reply With Quote
Old 08-21-2009, 06:01 PM   #36
greigite
Senior Member
 
Location: Cambridge, MA

Join Date: Mar 2009
Posts: 141
Default

You can get the SE and PE PCR primer sequences from the supplementary info of Bentley et al 2009 (http://www.ncbi.nlm.nih.gov/pubmed/18987734). I pulled these and did a comparison of PE and SE primers/adapters (p 9 of attached pdf).

Quote:
Originally Posted by der_eiskern View Post
so it's friday evening, and i was supposed to be amplifying my library before going home tonight however my coworker used all of our amplifying PCR Primers 2.1 and 1.1 for SE sequencing and I can't find an accurately labeled figure of the sequences for these SE PCR primers that Illumina sends out. I'm finding PE sequences everywhere though.

clarification?

Thanks.
Attached Files
File Type: pdf adapter illustration.pdf (60.6 KB, 1422 views)
greigite is offline   Reply With Quote
Old 08-21-2009, 06:22 PM   #37
der_eiskern
Member
 
Location: California

Join Date: Jul 2009
Posts: 46
Default

thanks greigite!
der_eiskern is offline   Reply With Quote
Old 09-09-2009, 02:30 PM   #38
tgdeering
Junior Member
 
Location: Texas

Join Date: Mar 2009
Posts: 1
Default

I am looking into making my own SE primers and noticed in the Bentley et al 2009 paper that they used phosphorothioate modified primers. Does anyone else who uses their own primers do this? Also, what purification for the oligos is needed? Standard desalting, PAGE, etc?
tgdeering is offline   Reply With Quote
Old 09-09-2009, 02:36 PM   #39
der_eiskern
Member
 
Location: California

Join Date: Jul 2009
Posts: 46
Default

i just got HPLC purified phosphorothioate primers today in the post. I'll try to post how happy i am with them.

i've run into problems after gel purifying the ligated adaptors with inefficient amplification, hopefully this helps...

we'll see.
der_eiskern is offline   Reply With Quote
Old 09-09-2009, 05:48 PM   #40
der_eiskern
Member
 
Location: California

Join Date: Jul 2009
Posts: 46
Default

tgdeering, phosphorothioate fixed my problems. before i could barely see a band after amplification but with phosphorothioate primers i got maximal amplification with iProof.
der_eiskern is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:18 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO