Hi, I've got some old small RNA datasets and I have something like 10% of all reads in all samples containing a specific sequence (TTAGCAATTTAACTGTGATAAACTACC, this is with grep -c, I bet there is much more with errors). All of these libraries were prepared in the same lab.
It's not among any of the contaminants used by FASTQC (adapters and stuff), not phiX174 (NC_001422), and blast hits hundreds of different plasmid vectors. Has anyone seen anything like this?
It's not among any of the contaminants used by FASTQC (adapters and stuff), not phiX174 (NC_001422), and blast hits hundreds of different plasmid vectors. Has anyone seen anything like this?