SEQanswers

Go Back   SEQanswers > General



Similar Threads
Thread Thread Starter Forum Replies Last Post
interpreting the CIGAR in the SAM format efoss Bioinformatics 2 10-29-2011 10:04 AM
BWA generating incorrect CIGAR string? foxyg Bioinformatics 6 09-16-2011 11:22 AM
question about bwa sam file peachgil Bioinformatics 1 04-06-2011 08:53 AM
the meaning of CIGAR column in SAM file outputs by BWA holywoool Bioinformatics 2 01-04-2011 04:34 AM
bwa MD and cigar fields inconsistency biterbilen Bioinformatics 4 07-28-2009 08:37 AM

Reply
 
Thread Tools
Old 09-01-2011, 10:04 PM   #1
qixiaofei
Junior Member
 
Location: China

Join Date: Sep 2011
Posts: 4
Default The 'S' in CIGAR of sam file (bwa)

the S means "soft clipping (clipped sequences present in SEQ)".
but I saw an example of CIGAR which is "72M28S" (4mismatch),and actually, there is only one mismatch in the 28S! I doubt why the result of aln is not 100M (5mismatch)? I saw Many similar situation ? who can help me ? thank U~
qixiaofei is offline   Reply With Quote
Old 09-02-2011, 07:01 AM   #2
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

Can you show is the read and alignment?
nilshomer is offline   Reply With Quote
Old 09-03-2011, 04:09 AM   #3
qixiaofei
Junior Member
 
Location: China

Join Date: Sep 2011
Posts: 4
Default

Quote:
Originally Posted by nilshomer View Post
Can you show is the read and alignment?
B80FGAABXX:6:23:6777:40030#0 83 chr10 42383349 10 28S72M = 42383248 -173 AATCAGATGGAATCATCGAATGGACTTGAATGGAATCGTTGAATGGACTCGAATGGAATCATTATTGAATGGAATTGAATAGAATCATCGAATGGTCTCG ??A??ED=E:ECD=?EDD:AEEEEEDFDGEDGFGEDFGEGEEGDGGBGGEDGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGG XT:A:M NM:i:5 SM:i:10 AM:i:10 XM:i:5 XO:i:0 XG:i:0 MD:Z:9A2A39G5T2C10
B80FGAABXX:6:25:6662:82018#0 147 chr10 42383349 10 30S70M = 42383248 -171 GGAATCAGATGGAATCATCGAATGGACTGGAATGGAATCATTGAATGGACTCGAAAGGGATCATTATTGAATGGAATTGAATGGAAGCATCGAATGGTCT DEFEAGFEGFFEF?BGGG?GDFFGEEGDFFGEGFDGGGGGGGGFGGGGFGGGEGGGGGGFEGGGGGGFGGGGGGGFEGGGGGGGGGGGGGGGGGGGGGFG XT:A:M NM:i:6 SM:i:10 AM:i:10 XM:i:6 XO:i:0 XG:i:0 MD:Z:12A12T2A27T1T2C8

I give two lines , and the ref before the pos 42383349 is ggaatcagatggaatcatcgaatggacttt(30bp) only the last 2 bp is mismatch with the second read given.
qixiaofei is offline   Reply With Quote
Old 09-03-2011, 05:25 AM   #4
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

I agree, looking at BLAT it seems as though this read is quite repetitive too, and is not annotated as such. It would be great to post to the bwa mailing list to file a bug.

What is your mismatch tolerance (show the command line)? BWA (short) will try to align a prefix of the read, and it may be hitting its mismatch/indel tolerance limit.
nilshomer is offline   Reply With Quote
Old 09-03-2011, 05:59 AM   #5
qixiaofei
Junior Member
 
Location: China

Join Date: Sep 2011
Posts: 4
Default

Quote:
Originally Posted by nilshomer View Post
I agree, looking at BLAT it seems as though this read is quite repetitive too, and is not annotated as such. It would be great to post to the bwa mailing list to file a bug.

What is your mismatch tolerance (show the command line)? BWA (short) will try to align a prefix of the read, and it may be hitting its mismatch/indel tolerance limit.
I only have the results, and don't know the command line. but there is "XM:i:22" on other line of the sam . the example I gave before only "XM:i:5"and "XM:i:6",respectively. I am a beginner, don't know the principle of bwa. why it happens?
qixiaofei is offline   Reply With Quote
Old 09-03-2011, 06:23 AM   #6
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

You will have to play with it yourself and read the paper. Unfortunately, it is beyond the scope of this forum for me to try to debug and explain it to you. Can you get the command line?
nilshomer is offline   Reply With Quote
Old 09-15-2011, 11:28 PM   #7
qixiaofei
Junior Member
 
Location: China

Join Date: Sep 2011
Posts: 4
Default

Quote:
Originally Posted by nilshomer View Post
You will have to play with it yourself and read the paper. Unfortunately, it is beyond the scope of this forum for me to try to debug and explain it to you. Can you get the command line?
I'm sorry for replying so late .
the command line as follows
bwa aln -n 3 -o 1 -e 15 -i 5 -l 32 -t 4
qixiaofei is offline   Reply With Quote
Reply

Tags
bwa, cigar

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:52 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO