![]() |
|
![]() |
||||
Thread | Thread Starter | Forum | Replies | Last Post |
BBMap (aligner for DNA/RNAseq) is now open-source and available for download. | Brian Bushnell | Bioinformatics | 678 | 12-12-2019 09:36 AM |
BBMap for BitSeq | dietmar13 | Bioinformatics | 1 | 04-30-2015 09:40 AM |
Please help my BBMap cannot remove Illumina adapter | TofuKaj | Bioinformatics | 4 | 04-28-2015 09:53 AM |
BBMap Error | Phage Hunter | Bioinformatics | 5 | 01-14-2015 05:34 AM |
Introducing BBMap, a new short-read aligner for DNA and RNA | Brian Bushnell | Bioinformatics | 24 | 07-07-2014 10:37 AM |
![]() |
|
Thread Tools |
![]() |
#201 |
I like code
Location: San Diego, CA, USA Join Date: Sep 2009
Posts: 438
|
![]()
Hello-
I'm trying to understand this example in the original post: Code:
bbmap.sh in=reads.fq outu=unmapped.fq int=f repair.sh in=unmapped.fq out=paired.fq fint outs=singletons.fq
__________________
/* Shawn Driscoll, Gene Expression Laboratory, Pfaff Salk Institute for Biological Studies, La Jolla, CA, USA */ |
![]() |
![]() |
![]() |
#202 |
Junior Member
Location: Switzerland Join Date: Jan 2018
Posts: 3
|
![]()
Hi guys,
I'm trying to get bbmap to find all hits up to some identity threshold for a 20bp read, but it only finds the perfect hit. This should be possible right? So I must be doing something wrong. Here's the test scenario: Code:
# file: sample.genome.fa > 10 GRCz10 TTTCCTGAGGATGTGAGATTACTTCCGGGTTTTACAACAACATGGCAGCGCCCTTAGGTCTGCATCTGGAGTTTGGGTTTGTATTTATTGTTTCCTTTATCATTAATCTATTTTTTTTTTCTTTCTCGTGTTTTTTAAGAACATGGCAGTTTTGTTTTACATCAACTTGGCAGTAAT # file sample.reads.fa: > r1 GTTTTACAACAACATGGCAG GTTTTTTAAGAACATGGCAG # run.bash bbmap.sh ref=sample.genome.fa k=3 bbmap.sh minid=0.7 k=3 maxindel=0 strictmaxindel ref=sample.genome.fa ambiguous=all in=sample.read.fa out=mapped.sam vslow # results: mapped.sam mapped.sam @HD VN:1.4 SO:unsorted @SQ SN: 10 GRCz10 LN:177 @PG ID:BBMap PN:BBMap VN:37.85 CL:java -Djava.library.path=/Users/milan/Projects/geneassassin/code/ga-pipeline/bin/bbmap/jni/ -ea -Xmx3200m align2.BBMap build=1 overwrite=true fastareadlen=500 minid=0.7 k=3 maxindel=0 strictmaxindel ref=sample.genome.fa ambiguous=all in=sample.read.fa out=mapped.sam vslow r1 0 10 GRCz10 29 40 20= * 0 0 GTTTTACAACAACATGGCAG * NM:i:0 AM:i:40 NH:i:1
Code:
# stdout: Max memory cannot be determined. Attempting to use 3200 MB. If this fails, please add the -Xmx flag (e.g. -Xmx24g) to your command, or run this program qsubbed or from a qlogin session on Genepool, or set ulimit to an appropriate value. java -Djava.library.path=/Users/milan/Projects/geneassassin/code/ga-pipeline/bin/bbmap/jni/ -ea -Xmx3200m -cp /Users/milan/Projects/geneassassin/code/ga-pipeline/bin/bbmap/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 minid=0.7 k=3 maxindel=0 strictmaxindel ref=sample.genome.fa ambiguous=all in=sample.read.fa out=mapped.sam vslow Executing align2.BBMap [tipsearch=150, minhits=1, minratio=0.25, rescuemismatches=50, rescuedist=3000, build=1, overwrite=true, fastareadlen=500, minid=0.7, k=3, maxindel=0, strictmaxindel, ref=sample.genome.fa, ambiguous=all, in=sample.read.fa, out=mapped.sam] Version 37.85 [tipsearch=150, minhits=1, minratio=0.25, rescuemismatches=50, rescuedist=3000, build=1, overwrite=true, fastareadlen=500, minid=0.7, k=3, maxindel=0, strictmaxindel, ref=sample.genome.fa, ambiguous=all, in=sample.read.fa, out=mapped.sam] Set MINIMUM_ALIGNMENT_SCORE_RATIO to 0.250 Retaining all best sites for ambiguous mappings. Set MINIMUM_ALIGNMENT_SCORE_RATIO to 0.449 NOTE: Ignoring reference file because it already appears to have been processed. NOTE: If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt Set genome to 1 Loaded Reference: 0.075 seconds. Loading index for chunk 1-1, build 1 Generated Index: 0.004 seconds. Analyzed Index: 0.002 seconds. Started output stream: 0.021 seconds. Cleared Memory: 0.116 seconds. Processing reads in single-ended mode. Started read stream. Started 8 mapping threads. Detecting finished threads: 0, 1, 2, 3, 4, 5, 6, 7 ------------------ Results ------------------ Genome: 1 Key Length: 3 Max Indel: 0 Minimum Score Ratio: 0.4486 Mapping Mode: normal Reads Used: 1 (20 bases) Mapping: 0.208 seconds. Reads/sec: 4.81 kBases/sec: 0.10 Read 1 data: pct reads num reads pct bases num bases mapped: 100.0000% 1 100.0000% 20 unambiguous: 100.0000% 1 100.0000% 20 ambiguous: 0.0000% 0 0.0000% 0 low-Q discards: 0.0000% 0 0.0000% 0 perfect best site: 100.0000% 1 100.0000% 20 semiperfect site: 100.0000% 1 100.0000% 20 Match Rate: NA NA 100.0000% 20 Error Rate: 0.0000% 0 0.0000% 0 Sub Rate: 0.0000% 0 0.0000% 0 Del Rate: 0.0000% 0 0.0000% 0 Ins Rate: 0.0000% 0 0.0000% 0 N Rate: 0.0000% 0 0.0000% 0 Total time: 0.571 seconds. |
![]() |
![]() |
![]() |
#203 |
I like code
Location: San Diego, CA, USA Join Date: Sep 2009
Posts: 438
|
![]()
@milan.molbio-
bbmap looks for the best alignment and reports only that one by default. If there are multiple "best" then you can get them all by setting 'ambig=all'. What you're looking for should be possible by enabling 'secondary=t' and then setting both 'sssr' and 'maxsites' to your liking. "secondary" alignments are those with lower mapping scores relative to the best alignment. "sssr" controls the ratio of the best score that is acceptable (default is 0.95 to allow secondary alignments with mapping scores as low as 95% of the best score). Finally "maxsites" sets a cap on the number of secondary alignment sites to report. You can probably just set that to a very high value to be sure you have them "all" - or at least all that bbmap can find.
__________________
/* Shawn Driscoll, Gene Expression Laboratory, Pfaff Salk Institute for Biological Studies, La Jolla, CA, USA */ |
![]() |
![]() |
![]() |
#204 |
Junior Member
Location: Switzerland Join Date: Jan 2018
Posts: 3
|
![]()
@sdriscoll thanks for the tip! with these two options bbmap does report one 100% semiperfect site read but it's not in the output file. Anything else I'm missing?
the exact command was: Code:
bbmap.sh secondary=t sssr=0.80 k=3 maxindel=0 strictmaxindel ref=sample.genome.fa ambiguous=all maxsites=10 in=sample.read.fa out=mapped.sam vslow |
![]() |
![]() |
![]() |
#205 |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,083
|
![]()
I am not sure why BBMap is not reporting the two sites in the output SAM. Perhaps that is by design.
Unfortunately @Brian has been missing from online forums for last couple of months. I pinged him again yesterday with ref to this question. We will need him to chime in on these questions. |
![]() |
![]() |
![]() |
#206 |
I like code
Location: San Diego, CA, USA Join Date: Sep 2009
Posts: 438
|
![]()
Yeah I've come to terms with the fact that BBMap wasn't really designed for this type of use. When I want to work with an alignment strategy where the goal is to find "all" alignments of a read up to some maximum error threshold I turn to bowtie (1 or 2) or BWA.
__________________
/* Shawn Driscoll, Gene Expression Laboratory, Pfaff Salk Institute for Biological Studies, La Jolla, CA, USA */ |
![]() |
![]() |
![]() |
#207 | |
Junior Member
Location: Switzerland Join Date: Jan 2018
Posts: 3
|
![]() Quote:
![]() |
|
![]() |
![]() |
![]() |
#208 |
Junior Member
Location: N. Cal Join Date: Apr 2014
Posts: 10
|
![]()
Hi Brian, I have a problem whereby I have a about 12 fastq files and I'm not completely convinced that the barcode for each of the samples are as named in the key. If I have 12 unique 6-mer barcodes eg GTCCGC, etc is there a way to definitively say which samples have the following barcode with bbmerge? thanks!
|
![]() |
![]() |
![]() |
#209 |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,083
|
![]()
I assume you are referring to a standard barcode/index from Illumina tech. If so those are never part of actual read. If they are present in the fastq header then you could use "demuxbyname.sh" to separate the reads you are interested in.
If your index is "inline" (and at a specific location in the read e.g. beginning) then you could use bbduk.sh to match/separate those reads. I am not sure bbmerge.sh is going to help in your case. |
![]() |
![]() |
![]() |
#210 | |
Super Moderator
Location: Walnut Creek, CA Join Date: Jan 2014
Posts: 2,707
|
![]() Quote:
Code:
bbmerge.sh in1=read1.fq in2=read2.fq outa=adapters.fa |
|
![]() |
![]() |
![]() |
#211 |
Super Moderator
Location: Walnut Creek, CA Join Date: Jan 2014
Posts: 2,707
|
![]()
While BBMap is not originally designed for this purpose; I made a version that does a much better job at finding all mappings above some identity threshold, bbmapskimmer.sh. The usage is the same as BBMap; just add the ambig=all flag.
|
![]() |
![]() |
![]() |
#212 |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,083
|
![]()
Does this mean that bbmap functions identically but does not report all the alignments in the output file but includes them in the statistics for alignment?
|
![]() |
![]() |
![]() |
#213 |
Member
Location: california Join Date: Feb 2012
Posts: 35
|
![]()
Is there a multi-sample pileup? I have a bunch of samples mapped to the same reference. It would be awesome to have that as a table with the coverage for each sample per reference sequence.
|
![]() |
![]() |
![]() |
#214 |
Junior Member
Location: Western Australia Join Date: Sep 2016
Posts: 5
|
![]()
Hello
My sequencing output largely consists of Illumina (NextSeq and Miseq) NON-overlapping paired end reads (the occasional reads will overlap, as the DNA is not all fragmented evenly). For ease of storage and to simplify input data at the start of a workflow, I would like to combine the files. If I understand correctly, bbmerge is specifically for merging overlapping reads? In which case I am best off simply using the bbmap reformat.sh to combine the reads in to one interleaved file? Code:
reformat.sh in1=read1.fq in2=read2.fq out=reads.fq Last edited by SDH; 10-17-2018 at 12:14 AM. Reason: typo. |
![]() |
![]() |
![]() |
#215 |
Junior Member
Location: California Join Date: Aug 2016
Posts: 4
|
![]()
Hello,
I have a reference and I have an additional genome sequenced via 10x that contains 150k contigs from 1k to 7.5Mb. I am attempting to align the second to the first with BBMap by using the flag maxlen=2000 as there are extensive rearrangements. This morning I found this error message. Can anyone tell me what might have happened? Thanks. Code:
'BBMap failed with error code 1 Executing align2.BBMapPacBio [maxlen=2000, maxindel=4000, ambiguous=random, k=15, saa=f, maxlen=6000, minratio=0.40, minscaf=100, startpad=10000, stoppad=10000, midpad=6000, ref=ref.fasta, out=bbmap.sam, in=reads1.fasta] BBMap version 37.64 Set MINIMUM_ALIGNMENT_SCORE_RATIO to 0.400 Choosing a site randomly for ambiguous mappings. Writing reference. Executing dna.FastaToChromArrays2 [ref.fasta, 1, writeinthread=false, genscaffoldinfo=true, retain, waitforwriting=false, gz=true, maxlen=536670912, writechroms=true, minscaf=100, midpad=6000, startpad=10000, stoppad=10000, nodisk=false] Set genScaffoldInfo=true Writing chunk 1 Writing chunk 2 Writing chunk 3 Writing chunk 4 Writing chunk 5 Writing chunk 6 Writing chunk 7 Set genome to 1 Loaded Reference: 0.007 seconds. Loading index for chunk 1-7, build 1 No index available; generating from reference genome: /Users/wilfordbrimley/Geneious Prime/temp/17/ref/index/1/chr1-3_index_k15_c2_b1.block No index available; generating from reference genome: /Users/wilfordbrimley/Geneious Prime/temp/17/ref/index/1/chr4-7_index_k15_c2_b1.block Indexing threads started for block 0-3 Indexing threads started for block 4-7 Indexing threads finished for block 0-3 Indexing threads finished for block 4-7 Generated Index: 249.271 seconds. Analyzed Index: 71.551 seconds. Started output stream: 0.096 seconds. Cleared Memory: 0.195 seconds. Processing reads in single-ended mode. Started read stream. Started 24 mapping threads. Exception in thread "Thread-29" java.lang.AssertionError: -30, -30 89764, 2,0,149134394,149142098,0,00,971,475770,460506,0,389847,149134394~149139756~149140058~149142098,mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmSmmmmmmmmmmmSmmmSmmmmmmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmSmmmmmmmmmmSmmmmmmmmmmmmmmmSmmmmmmmmmmmmmmmmmmmmmmmmmmSmmmSmmmmmmmmmmmmmmmSm ... GCATTCAGACAAGGGTAGCAATATCAATCAACTCTATCTGCTTACAGGAATTGAGCTAGCATAAAGTGCTAAACTCATACTATCAGGCATAACCTAGTCAGGCTATCCTACTTACTGTCTACTCAATATAGGGGTGAGCATTTGGACCGGTGGACCGGACCGGACCGGTGAACCGGACCGGACCGAACCGGATCGGACCGTTTTTTTGGACCCCCGGGCCGGTTCTCGGTTCTAAGATTTCTCGCCGGCCCGGTCTGGTTTTTTTCCCGGTCCGGTCCGGTTTTTACCGGGTTTAGAACCGGTTGGACATGATTAAGATTTTTGTGACGTTTTTTAAACGCACATAACTCATTTGTTTTAAGTTGGATTGACCTGCGGTTTTTCCAACATTTAGTTTACAATTTGTAGATGAATTTAGACTATAATTTTGTTTATTTTGGTATTATATTCACCGTGTTACAATCCTTCAAAGTAGACCTAACAAAGCTGAAAAAATTCAGTTTTTCAGCAACATTTTGTAAGCTGTGACGTTTTTTAAACATCCATAACTCATTCGTTTTAATTCGGATTGACCTCCGATTTTTTCCAACATTTAGTTTACAGTTTGTAGATGAGTTTAGACTATAATTTTGTTTATTTTGGTATTATATTCACTGAGCTACAATCCTTTAAAGTAGAGCTATCAAAGTTGAAAAAATTTAGCTTTTTAGCAAAATTTTATAATCTGTGACGTTTTTTAAACACCCATAACTCATTCGTTTTAAGTTGGATTGACCTACGGTTTTTTCCAACATTTAGTTTACAATTTGTAGATGAATTTAGACTATAATTTTGTTTATTTTGGTATTATATGCATTGAGTTACAATCCTTCAAAGTAGAGCTATCAAAGCTGAAATATTTCAGCTTTTTAGTATTATTTTATACTATAATCCCGAGTCCGCGTTTAGCACTTGTGGTAGAGTTGTAAGTGAGTATCAAACTAGTTTATCGACATTGATAGTTGAAGCTTTGTTATGCACCCAAGATTGGGTGATAAAGTTTACAAATCCGATAGTTGACAACGTTGGTGACATCTTGAACGATGATGATATAACTTTGGGTAAAAAAATTACAATCTTTATTCTTTTTTTATACAATTATTACTTTTTATTAAATACTAACAACATTTTCATTTGTGTTTATGTAGAGATTGCACAAGCTTTAAATATGTTACATATGGATGACAATGATATGGGGAAGAGGCCAATAGAAGATTAGATTATGAGTTTATGAAATTTGTTAGTTTGATTGATTTTAAAGTTTAAACTATGATTTTTGTTGTTACGGTAATACTTTTGTATGTTTGTCTTAAAATTGTTTAACTTTTGTTGGTGAACTTGATTTATATGTTAGTTGCTTTTATTTGGAAAATTAATTTTTGCAAATTGCAAGTTATAATATTATACATCAATGTAGATTAGTTAGGCATGAAACGGAAACATATTAATTTTGCAAGTTATAATATTATACATCAATGTAGATTACTTATTATACTCTATGCAATTAAAGTTGTACCGGTCCAAACGAGTCCAAAAACCGGAAAACCCGGACCTAGACCCGGACACGGACACGGACACGGACACGACTAATCCGGTCCGGTCCATGGTCCACAAAATTCTCCATAGCCGGTCCGGTCCGATTCGGTCCGGGCCTGTCCAAATGCTCACCCCTAACTTAATATCTAGCATGCAATTCTTATACAACTGAAACACATAAAGCAGGCACATAAGGCATCACTCCTAGATCCTTAGTCCTATTCTAGCATGCTGTTCTACAAAAGCTGATAAACATAACATAAACTTGTAAGGGTACTTTGGGGAATACTTACTTGAGCTCGGCCGGTCGCGCACATCACACACTTCGTTCTTTCTCGAAACTCTTTTCTTAGTTTTTTAGAAAACATTTTCTTTTTAGAAAATCTTTTAATCCCTTGATTTGAGTTCAGACACCCCCGAAGGTGTGTCCGAATCCCTCAAACCAGGGCTCTGATACCAACTTGTAACGACCCAAATTTCACGTTCAAAAATTTCGTTTTAAAATGTTACTTTAGAAAACATTAATAATTAAAACATTGTTTGATCAAACCATAACACAACGTAAACCATGTCTAAAAGCCAAATCACACAACCAATCAAACATCAGAGTATAAAACCCAAAGAATCTCG at align2.MultiStateAligner9PacBio.makeGref(MultiStateAligner9PacBio.java:1388) at align2.MultiStateAligner9PacBio.fillLimited(MultiStateAligner9PacBio.java:96) at align2.TranslateColorspaceRead.realign_new(TranslateColorspaceRead.java:565) at align2.TranslateColorspaceRead.realign_new(TranslateColorspaceRead.java:641) at align2.AbstractMapThread.genMatchStringForSite(AbstractMapThread.java:1006) at align2.AbstractMapThread.genMatchString(AbstractMapThread.java:902) at align2.BBMapThreadPacBio.processRead(BBMapThreadPacBio.java:563) at align2.AbstractMapThread.run(AbstractMapThread.java:502) Detecting finished threads: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 ************************************************************************** Warning! 2 mapping threads did not terminate normally. Check the error log; the output may be corrupt or incomplete. Please submit the full stderr output as a bug report, not just this message. ************************************************************************** ------------------ Results ------------------ Genome: 1 Key Length: 15 Max Indel: 4000 Minimum Score Ratio: 0.4 Mapping Mode: normal Reads Used: 581616 (2969452913 bases) Mapping: 177826.639 seconds. Reads/sec: 3.27 kBases/sec: 16.70 Read 1 data: pct reads num reads pct bases num bases mapped: 81.2921% 472808 78.5245% 2331747518 unambiguous: 76.0459% 442295 75.7328% 2248849209 ambiguous: 5.2462% 30513 2.7917% 82898309 low-Q discards: 12.7684% 74263 15.0015% 445463533 perfect best site: 4.9337% 28695 4.2346% 125743838 semiperfect site: 5.0009% 29086 4.2700% 126794871 Match Rate: NA NA 84.9205% 2173341879 Error Rate: 87.8894% 442044 13.2182% 338289025 Sub Rate: 84.8676% 426846 1.8940% 48472068 Del Rate: 67.4695% 339341 8.8901% 227520440 Ins Rate: 68.5198% 344624 2.4342% 62296517 N Rate: 30.3789% 152792 1.8614% 47637054 Exception in thread "main" java.lang.AssertionError: The number of reads out does not add up to the number of reads in. This may indicate that a mapping thread crashed. If you submit a bug report, include the entire console output, not just this error message. 238640+234168+0+34543+74263 = 581614 != 581616 at align2.AbstractMapper.printOutputStats(AbstractMapper.java:1892) at align2.AbstractMapper.printOutput(AbstractMapper.java:1022) at align2.BBMapPacBio.testSpeed(BBMapPacBio.java:462) at align2.BBMapPacBio.main(BBMapPacBio.java:37) ' Last edited by Grammatonotus; 02-22-2019 at 09:10 PM. |
![]() |
![]() |
![]() |
#216 |
Junior Member
Location: California Join Date: Aug 2016
Posts: 4
|
![]()
A little bit more information: the DNA sequence in the error message maps to the middle of a contig about 2.8 Mb, starts 402,000 bases in. I tried running this both locally and on a cluster and got the same error message with almost exactly the same sequence in each-- 2045 bases in one, 2205 bases in the other, with ~99% overlap. Any insights appreciated.
|
![]() |
![]() |
![]() |
#217 |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,083
|
![]()
@grammtonotus: How much memory are you allocating for this job? With that large sized fragments you are likely going to need plenty.
I also suggest that you look into using `minimap2` from Heng Li as an alternate option to BBMap. |
![]() |
![]() |
![]() |
#218 |
Junior Member
Location: California Join Date: Aug 2016
Posts: 4
|
![]()
When I run it locally about 52 Gb (I ran out of system memory when I had it set to 58), on the cluster 439 Gb. I hope that's not the problem!
|
![]() |
![]() |
![]() |
#219 |
Junior Member
Location: California Join Date: Aug 2016
Posts: 4
|
![]()
a colleague suggests that the mapper may have come to a read that hits too many places in the reference. I have it set to place this at Random, would changing to First Best, None, or All be likely to give a different result?
Also wondering if setting maxlen=4000 might change anything. I don't know how diverged the two are so kind of just guessing really. Thanks. |
![]() |
![]() |
![]() |
#220 |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,083
|
![]()
Let us know if using more memory made a difference.
You should really be using a different tool designed for long read alignments. Even LASTZ may be appropriate since you have query sequences as long as 7.5Mb. |
![]() |
![]() |
![]() |
Tags |
bbmap |
Thread Tools | |
|
|