![]() |
|
![]() |
||||
Thread | Thread Starter | Forum | Replies | Last Post |
"allele balance ratio" and "quality by depth" in VCF files | efoss | Bioinformatics | 2 | 10-25-2011 12:13 PM |
Relatively large proportion of "LOWDATA", "FAIL" of FPKM_status running cufflink | ruben6um | Bioinformatics | 3 | 10-12-2011 01:39 AM |
The position file formats ".clocs" and "_pos.txt"? Ist there any difference? | elgor | Illumina/Solexa | 0 | 06-27-2011 08:55 AM |
"Systems biology and administration" & "Genome generation: no engineering allowed" | seb567 | Bioinformatics | 0 | 05-25-2010 01:19 PM |
SEQanswers second "publication": "How to map billions of short reads onto genomes" | ECO | Literature Watch | 0 | 06-30-2009 12:49 AM |
![]() |
|
Thread Tools |
![]() |
#1 | |
Junior Member
Location: Europe Join Date: Mar 2012
Posts: 3
|
![]()
Hi everyone,
I started using HTSeq a couple of days ago and now encountered a problem. Maybe someone knows a workaround. I am interating over an sam file and cant find a solution for the error: (also described here http://seqanswers.com/forums/showthread.php?t=12091) Quote:
Like: blaaaaa ACTACTATCTAC * blaaaaa Since I have a lot of files I cant perform a filtering in the first place, because I do not want to touch those big files twice. thanks in advance. EDIT: I am using the latest release of HTSeq. regards Last edited by kamsen; 04-04-2012 at 08:06 AM. |
|
![]() |
![]() |
![]() |
#2 |
Peter (Biopython etc)
Location: Dundee, Scotland, UK Join Date: Jul 2009
Posts: 1,543
|
![]()
Sounds like a bug in HTSeq - as discussed in the linked thread, the SAM/BAM file format explicitly allows the sequencing qualities to be omitted (which in SAM is represented with the * character).
Have you contacted the HTSeq authors? P.S. Saying you use the latest version isn't as helpful as saying the actual version you are using. People may read this thread later on ![]() |
![]() |
![]() |
![]() |
#3 |
Senior Member
Location: Heidelberg, Germany Join Date: Feb 2010
Posts: 994
|
![]()
Yes, that's a limitation of HTSeq. Fixing this has been on my to-do list since a while; sorry that it's still not done.
|
![]() |
![]() |
![]() |
#4 |
Junior Member
Location: Europe Join Date: Mar 2012
Posts: 3
|
![]()
Just a few remarks to close this topic:
1) I was talking about version 0.5.3p3 ![]() 2) I made quick & dirty workaround in the code (__init__ modul l. 537) which worked for me. If somebody encounters this problem one could easily just return the line from the .sam file and create 0 qualities / read the original ones. After that the conversion to the Alignment format will work again. 3) Thanks anyway for your nice package Simon! regards |
![]() |
![]() |
![]() |
#5 | |
not just another member
Location: Belgium Join Date: Aug 2010
Posts: 264
|
![]() Quote:
Do you fix this bug ? I've the same problem with tophat 2.0.0 bam files. Code:
samtools view -h -o out.sam in.bam htseq-count out.sam annotation.gtf > htseq_out.txt Code:
100000 GFF lines processed. 200000 GFF lines processed. 283699 GFF lines processed. Error occured in line 36 of file out.sam. Error: ("'seq' and 'qualstr' do not have the same length.", 'line 36 of file out.sam') [Exception type: ValueError, raised in _HTSeq.pyx:765] |
|
![]() |
![]() |
![]() |
#6 |
Senior Member
Location: Heidelberg, Germany Join Date: Feb 2010
Posts: 994
|
![]()
I've just fixed this. In HTSeq 0.5.3p4, SAM files with "*" in the quality field are accepted. Sorry that this took a while.
|
![]() |
![]() |
![]() |
#7 |
not just another member
Location: Belgium Join Date: Aug 2010
Posts: 264
|
![]()
Thanks Simon, it worked great.
|
![]() |
![]() |
![]() |
#8 |
Junior Member
Location: United States Join Date: Apr 2011
Posts: 6
|
![]()
Dear Simon,
You are my hero. Just ran into this problem yesterday. And by this morning a solution was already in place. I owe you a beer. |
![]() |
![]() |
![]() |
#9 |
Junior Member
Location: United States Join Date: Apr 2011
Posts: 6
|
![]()
I should also add that I installed HTSeq-0.5.3p3 to encounter the qual problem and upon installing HTSeq-0.5.3p4, all was well.
|
![]() |
![]() |
![]() |
#10 |
Junior Member
Location: UK Join Date: Jan 2012
Posts: 7
|
![]()
Dear Simon,
I had installed the latest version of HTseq (HTSeq-0.5.3p5.tar.gz) to solve the problem but it looks like for me the error still persists. I am still facing this error: Error: ("'seq' and 'qualstr' do not have the same length.", 'line 2671032 of file ..) [Exception type: ValueError, raised in _HTSeq.pyx:765] Can you please help me out? Thanks, Dharanya |
![]() |
![]() |
![]() |
#11 |
Peter (Biopython etc)
Location: Dundee, Scotland, UK Join Date: Jul 2009
Posts: 1,543
|
![]()
It would be nice if the HTSeq error message included the two unmatched lengths - but can you show us what line 2671032 of your input file is? This may not be due to the * for missing qualities at all, but a real error in the data.
|
![]() |
![]() |
![]() |
#12 |
Junior Member
Location: UK Join Date: Jan 2012
Posts: 7
|
![]()
Hi,
Here is the line from that file: HWI-ST790:1:1101:1261:140607#ACTTGA 329 contig_126150 342 3 100M * 0 0 GTCCAGGTTGGTGGACCTCTCAATCATGTTGTCACCCTCAAACCCAGAGATGGGGACGAAGGGAACCTTGTTAGGGTTGTAGCCGACCTTCTTCAGGTAG * AS:i:-7 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:3A67C28 YT:Z:UU NH:i:2 CC:Z:contig_223383 CP:i:208 HI:i:0 Cheers, Dharanya |
![]() |
![]() |
![]() |
#13 |
Peter (Biopython etc)
Location: Dundee, Scotland, UK Join Date: Jul 2009
Posts: 1,543
|
![]()
Can you double check which HTSeq you are using? Perhaps an older copy is taking precedence in your PATH, or the update didn't install properly.
|
![]() |
![]() |
![]() |
#14 |
Junior Member
Location: UK Join Date: Jan 2012
Posts: 7
|
![]()
May be there might be a problem with the installation. I will go through it again and let you know if there are any problems still.
Thanks |
![]() |
![]() |
![]() |
#15 |
Senior Member
Location: US Join Date: Jan 2009
Posts: 392
|
![]()
As an aside, the latest version of Tophat 2 no longer has the "*" qualities problems.
|
![]() |
![]() |
![]() |
#16 |
Junior Member
Location: UK Join Date: Jan 2012
Posts: 7
|
![]() |
![]() |
![]() |
![]() |
#17 |
Member
Location: Ireland Join Date: May 2012
Posts: 11
|
![]()
I am having the same issue with HTSeq dealing with alignments from Tophat 2.
I installed HTSeq/0.5.3p5 but the issue persists. The alignments were done using Tophat 2.0.0 Code:
Error occured in line 36 of file R13a_m_accepted_hits.sam. Error: ("'seq' and 'qualstr' do not have the same length.", 'line 36 of file R13a_m_accepted_hits.sam') [Exception type: ValueError, raised in _HTSeq.pyx:765] Incidentally, when I was checking the installation as suggested above, the following appears with the v0.5.3p5 of HTSeq: Code:
>htseq-count .... >Released under the terms of the GNU General >Public License v3. Part of the 'HTSeq' framework, version 0.5.3p3. |
![]() |
![]() |
![]() |
#18 |
Junior Member
Location: UK Join Date: Jan 2012
Posts: 7
|
![]()
Hi
As far as I know, I think the only option will be to rerun the TopHat with the new version (v2.3). I think the only problem is dealing with the * qualities in the sam files and that has been resolved in the latest version. |
![]() |
![]() |
![]() |
#19 | |
Member
Location: Turin, Italy Join Date: Oct 2010
Posts: 66
|
![]() Quote:
Same here. Re-aligning all the reads with the new tophat would be cumbersome, I'll try to dig in the python and find a workaround... |
|
![]() |
![]() |
![]() |
#20 |
Senior Member
Location: Heidelberg, Germany Join Date: Feb 2010
Posts: 994
|
![]()
Sorry, it seems we made some mix-up between version 0.5.3p4 and 0.5.3p5. Essentially, p5 undid some fixes in p4, including the one for "*" qualities. Now, there is version 0.5.3p6, which should clean up this mess. Please let me know if you still have problems.
|
![]() |
![]() |
![]() |
Tags |
bowtie2, htseq, quality, sam |
Thread Tools | |
|
|