Complete ligation adaptor sequences

[Apex]

Hello everyone,

I am producing Ion Torrent sequencing libraries both using the ligation based library kit and the ampliseq strategy. The only adaptor sequences I can find from Lifetech are the ones involved in ampliseq:

Forward primer (Primer A-key):
5’-CCATCTCATCCCTGCGTGTCTCCGACTCAG-template-specific-sequence-3’
Reverse primer (Primer P1-key):
5’-CCTCTCTATGGGCAGTCGGTGAT-template-specific-sequence-3’

For quantitation purposes I use the Taqman based qPCR kit. This is however only possible with the ligated libraries. On this basis I assume the double stranded oligos used for ligation contains a longer sequence, than the one generated in the ampliseq PCR.

Does anyone have this sequence of the ligation adaptors?

I know this may well, for some obscure reason, be one of Lifetechs little secrets and that I may have to go through the trouble of cloning and sequencing the adaptors myself.

[genseq]

Originally Posted by Apex

Does anyone have this sequence of the ligation adaptors?

Ion A Adapter (non-barcoded)

....5'—CCATCTCATCCCTGCGTGTCTCCGACTCAG–3'
3'—T*T*GGTAGAGTAGGGACGCACAGAGGCTGAGTC-5'

Ion P1 Adapter

....5'—CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT–3'
3'—T*T*GGTGATGCGGAGGCGAAAGGAGAGATACCCGTCAGCCACTA-5'

http://seqanswers.com/forums/attachm...1&d=1343464421

[Apex]

Exactly what I was looking for! Thank you very much genseq!

[IonTorrent]

Hi Apex,

The sequences of the fragment library adaptors can be found in Appendix D (pp. 45) of the current Ion Xpress™ Plus gDNA Fragment Library Preparation User Guide, as available on the Ion Community.

Ion AmpliSeq™ Custom Panels may be designed using the Ion AmpliSeq™ Designer website.

Originally Posted by Apex

Hello everyone,

I am producing Ion Torrent sequencing libraries both using the ligation based library kit and the ampliseq strategy. The only adaptor sequences I can find from Lifetech are the ones involved in ampliseq:

Forward primer (Primer A-key):
5’-CCATCTCATCCCTGCGTGTCTCCGACTCAG-template-specific-sequence-3’
Reverse primer (Primer P1-key):
5’-CCTCTCTATGGGCAGTCGGTGAT-template-specific-sequence-3’

For quantitation purposes I use the Taqman based qPCR kit. This is however only possible with the ligated libraries. On this basis I assume the double stranded oligos used for ligation contains a longer sequence, than the one generated in the ampliseq PCR.

Does anyone have this sequence of the ligation adaptors?

I know this may well, for some obscure reason, be one of Lifetechs little secrets and that I may have to go through the trouble of cloning and sequencing the adaptors myself.

[JoF]

Hi,
I'm new to Life Tech semi conductor Sequencing and only have MiSeq experience. We were offered a demo run of the Ion S5 and I would like to produce the library beforehand with our custom protocol.

Can anyone tell me if the Ion torrent adaptors are the same for the Ion S5?

Fwd: CCATCTCATCCCTGCGTGTCTCCGACTCAG

Rev: CCTCTCTATGGGCAGTCGGTGAT

cheers,
JoF