weird output with BWA paired end alignment

jmt · 10-09-2012, 11:19 PM

Hi all,

I'm running into something strange.

I'm trying to do paired-end alignment with BWA.

I did the following:

bwa aln fasta pair1.fastq > pair1.sai
bwa aln fasta pair2.fastq > pair2.sai

Then, I did

bwa sampe fasta pair1.sai pair2.sai pair1.fasta pair2.fastq > bam

However, when I looked at my bam, I got alignments such as this:

seq1 117 chr10 49643024 0 * = 49643024 0 CCCGTATAACTCCATTCTTGGTTCTCTCCTCCAAGTCCATAACTTCCTTATATATCAATTCTTTCCACT
seq1 153 chr10 49643024 37 100M = 49643024 0 AGACAGCAGTCTAGAAGCAGCAGCTGGGCCTCTGGGCTGCTGTAGATGACTACTTGGGCCATCGGGGGG

My question is: shouldn't seq1 (first in pair; flag 117) have a "*" under column 3, signifying that it's unaligned?

What is going on here?

sudders · 10-10-2012, 01:37 AM

We've noticed this as well. BWA seems to give a position to unaligned reads.

jp. · 08-13-2013, 07:05 PM

How about if give commands like this:
bwa aln -t 4 -f Sample_R1.sai ./hg19.fasta ./Sample_R1.fastq
bwa aln -t 4 -f Sample_R2.sai ./hg19.fasta ./Sample_R2.fastq

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
The best output format for paired-end alignment using bowtie	chedonat	Bioinformatics	4	02-01-2012 02:03 PM
weird BWA SAM (samse) output	attilav	Bioinformatics	3	12-21-2011 05:15 PM
Weird Bowtie Alignment Result (unaligned remaining in output file)	DrD2009	Bioinformatics	2	07-16-2010 09:24 AM
BWA alignment for paired end reads	AvinashP	Genomic Resequencing	2	06-08-2010 04:11 AM
how paired end alignment works?	totalnew	Bioinformatics	8	04-27-2009 01:46 PM

10-09-2012, 11:19 PM	#1
jmt Junior Member Location: Philadelphia Join Date: Jun 2011 Posts: 5	weird output with BWA paired end alignment Hi all, I'm running into something strange. I'm trying to do paired-end alignment with BWA. I did the following: bwa aln fasta pair1.fastq > pair1.sai bwa aln fasta pair2.fastq > pair2.sai Then, I did bwa sampe fasta pair1.sai pair2.sai pair1.fasta pair2.fastq > bam However, when I looked at my bam, I got alignments such as this: seq1 117 chr10 49643024 0 * = 49643024 0 CCCGTATAACTCCATTCTTGGTTCTCTCCTCCAAGTCCATAACTTCCTTATATATCAATTCTTTCCACT seq1 153 chr10 49643024 37 100M = 49643024 0 AGACAGCAGTCTAGAAGCAGCAGCTGGGCCTCTGGGCTGCTGTAGATGACTACTTGGGCCATCGGGGGG My question is: shouldn't seq1 (first in pair; flag 117) have a "*" under column 3, signifying that it's unaligned? What is going on here?

10-10-2012, 01:37 AM	#2
sudders Member Location: Sheffield, UK Join Date: Dec 2011 Posts: 32	We've noticed this as well. BWA seems to give a position to unaligned reads.

08-13-2013, 07:05 PM	#3
jp. Senior Member Location: NikoNarita.jp Join Date: Jul 2013 Posts: 142	How about if give commands like this: bwa aln -t 4 -f Sample_R1.sai ./hg19.fasta ./Sample_R1.fastq bwa aln -t 4 -f Sample_R2.sai ./hg19.fasta ./Sample_R2.fastq