SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
SHRiMP alignment results for colorspace miRNA dsidote Bioinformatics 2 11-10-2011 10:32 AM
Plasma DNA Puzzle whw Sample Prep / Library Generation 9 08-03-2011 11:41 AM
puzzle in fq_all2std.pl biocc Bioinformatics 0 11-25-2010 04:33 AM
blast puzzle anyone1985 Bioinformatics 1 09-06-2009 02:45 AM
format puzzle anyone1985 Illumina/Solexa 0 03-13-2009 04:29 AM

Reply
 
Thread Tools
Old 11-21-2013, 05:55 AM   #1
Sergio.pv
Member
 
Location: Berlin

Join Date: Jul 2013
Posts: 20
Default puzzle with gmapper -M mirna (shrimp)

Hi everyone,
i am mapping short reads from ion torrent PGM. Reads are QV~20 and 16-155 length.
In FastQC appears this as the highest represented read:
TGAGGTAGTAGGTTGTGTGGTT 19528counts

Runing a quick blast it matches 100% bta-let-7b (bta my sp of interest):
UserSe 1 ugagguaguagguugugugguu 22
bta-let-7b 1 ugagguaguagguugugugguu 22

Of course I can't do this with all my reads, so i mapped them to all ncRNAs and mirna-stem-loops for bos taurus, using shrimp in mirna mode:

gmapper-ls myfile.fa P1_adapter.fa bta-ncRNAs.fa -M mirna >myfile.out 2>myfile.log

After counting the repeated elements in the RNAME coulumn of the SAM file, bta-let-7b appears nowhere and neither the corresponding miRNAs for the other highly counted reads.

I have tried this again using same parameters with only stem loops and then only mature mirna sequences.

In all trials the resuls were the same.

Hope you can come up with soemthing, i will keep trying other settings for gmapper and I will let you know how it went.

Thaks!

Last edited by Sergio.pv; 11-21-2013 at 05:57 AM.
Sergio.pv is offline   Reply With Quote
Old 11-21-2013, 07:16 AM   #2
Sergio.pv
Member
 
Location: Berlin

Join Date: Jul 2013
Posts: 20
Default

I did the following, as a test:
first, i use the above metioned sequences (identical as you can see)
>bta-let-7b MIMAT0004331
UGAGGUAGUAGGUUGUGUGGUU
>dummy
UGAGGUAGUAGGUUGUGUGGUU

gmapper-ls dummy-seq.fa dummy-let-7b.fa -N 12 -o 10 -h 80% >map.out 2>map.log

Output:
HD VN:1.0 SO:unsorted
@SQ SN:bta-let-7b LN:22
@PG ID:gmapper VN:2.2.3 CL:gmapper-ls dummy-seq.fa dummy-let-7b.fa -N 12 -o 10 -h 80%
dummy 0 bta-let-7b 1 250 22M * 0 0 NGAGGNAGNAGGNNGNGNGGNN *

Which is ok.

But if I change the dummy sequence (U -> T), into the original output of the sequencer (Us as Ts) i don't get results:
@HD VN:1.0 SO:unsorted
@SQ SN:bta-let-7b LN:22
@PG ID:gmapper VN:2.2.3 CL:gmapper-ls dummy-seq.fa dummy-let-7b.fa -N 12 -o 10 -h 80%

It seems that the use of Ts is not computed. Is that correct?, is there an option to modifify that?

Best!
Sergio.pv is offline   Reply With Quote
Old 11-22-2013, 02:45 AM   #3
Sergio.pv
Member
 
Location: Berlin

Join Date: Jul 2013
Posts: 20
Default

Ok, to make it work i converted U into T and it worked.
if it is any use, with fastx tool kit:

fasta_nucleotide_changer -v -i bta-stem-loops.mirbase20.fa -o bta-stemloops.fa -d
Sergio.pv is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:18 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO