samtools view error: CIGAR and sequence length are inconsistent (tophat/bowtie)

glacierbird · 06-29-2010, 02:09 AM

Hi,
When I try to use "samtools view" to creat .bam file from .sam, I get these error msg. The .sam file is created by mapping raw illumina reads with tophat.

samtools view -bS -t index.fa.fai -o accepted_hits.bam accepted_hits.sam
The tag [ID] required for [PG] not present.
[sam_header_read2] 7409 sequences loaded.
Parse error at line 8263: CIGAR and sequence length are inconsistent

This #line 8263 is like this:

head -n 8263 accepted_hits.sam |tail -n 1
HWI-EAS210R:5:55:1018:1930#0 0 SL1.00sc00002 428427 0 36M92N36M473N536870911M * 0 0 CTCATCTCTCATCTCAGAGAGGTCCTCCAGGAGCAGGAATATAAGTTGGATCAAGTACGCAATCATCTTCA XXQZXR^Ta\[a\ZVZ^ZYXWWYPSUMSSQXZTO^ZZPV_\`_U\VYY[W^G\SJSTTRTUTXFTTQTYVS NM:i:0 XS:A:+ NS:i:0

Anybody could explain me why Samtools gave such error msg?

Thanks!

glacierbird · 06-29-2010, 02:29 AM

I think the problem is caused by:

36M92N36M473N536870911M

But, I don't know how could it occur?

glacierbird · 06-29-2010, 02:58 AM

I think the solution could be:
reformat the raw .fastq file.

Maybe, somewhere is not Tab, but space.

then, 536870911M
will not occur.

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
TopHat Error: Could not find Bowtie index files /bowtie-0.12.5/indexes/.	rebrendi	Bioinformatics	11	06-22-2016 10:55 AM
Sequence and quality are inconsistent	myronpeto	Bioinformatics	9	10-29-2013 03:06 PM
samtools view error after reheader	Hkins552	Bioinformatics	3	07-17-2011 11:32 AM
Samtools view error message	Jan	Bioinformatics	4	06-07-2010 03:45 PM
tophat - cannot view sam output in samtools tview	lmilne	Bioinformatics	2	12-01-2009 01:13 PM

06-29-2010, 02:09 AM	#1
glacierbird Member Location: germany Join Date: Dec 2009 Posts: 15	samtools view error: CIGAR and sequence length are inconsistent (tophat/bowtie) Hi, When I try to use "samtools view" to creat .bam file from .sam, I get these error msg. The .sam file is created by mapping raw illumina reads with tophat. samtools view -bS -t index.fa.fai -o accepted_hits.bam accepted_hits.sam The tag [ID] required for [PG] not present. [sam_header_read2] 7409 sequences loaded. Parse error at line 8263: CIGAR and sequence length are inconsistent This #line 8263 is like this: head -n 8263 accepted_hits.sam \|tail -n 1 HWI-EAS210R:5:55:1018:1930#0 0 SL1.00sc00002 428427 0 36M92N36M473N536870911M * 0 0 CTCATCTCTCATCTCAGAGAGGTCCTCCAGGAGCAGGAATATAAGTTGGATCAAGTACGCAATCATCTTCA XXQZXR^Ta\[a\ZVZ^ZYXWWYPSUMSSQXZTO^ZZPV_\`_U\VYY[W^G\SJSTTRTUTXFTTQTYVS NM:i:0 XS:A:+ NS:i:0 Anybody could explain me why Samtools gave such error msg? Thanks!

06-29-2010, 02:29 AM	#2
glacierbird Member Location: germany Join Date: Dec 2009 Posts: 15	I think the problem is caused by: 36M92N36M473N536870911M But, I don't know how could it occur?

06-29-2010, 02:58 AM	#3
glacierbird Member Location: germany Join Date: Dec 2009 Posts: 15	I think the solution could be: reformat the raw .fastq file. Maybe, somewhere is not Tab, but space. then, 536870911M will not occur.